GenePrediction:GLEAN_8196 Details

Name: GLEAN_8196
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:414945..412126 (- strand)
Length: 2820
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:414945..414019 (- strand)
Length: 927
Type: CDS
Source: GLEAN
Position: GCSC_113:413955..413929 (- strand)
Length: 27
Type: CDS
Source: GLEAN
Position: GCSC_113:413850..412699 (- strand)
Length: 1152
Type: CDS
Source: GLEAN
Position: GCSC_113:412638..412547 (- strand)
Length: 92
Type: CDS
Source: GLEAN
Position: GCSC_113:412144..412126 (- strand)
Length: 19
>GLEAN_8196 class=GenePrediction position=GCSC_113:414945..412126 (- strand)
ATGCAAAACCGCATCGACCGTCTCGAGGGTCTGGTGCTGTCGCTGATGCACAGTGGAGCCGATGTCGATCCTATTACGGC
CGCATCTGCCGCGGGCATGGTTCCTGGCGCAGGGGTTGGCTTGCCGCCCAGGGCAGACAGCTTGGTGTCTACAAGAGAAA
GCGCGAACCAGGCGGCCGACGACGCGGATGACAGCGACATCGACGACGGCCTGGCGACCTCTCTCGGTGTTCTCAAGGTC
GACACGGATCGCGGAAAGTCCATGTATGTCGGCCAGGAGCACTGGCACACTCTACTGGCCGATATTACCGAAGTTAAGAA
CTATTTCACTATGCACAAGAAGGAGCTGGAGTCGAGTTACGAGAAGGTTCTCGAGAGCAAGCCGGCCACCTCCCGAGAGG
CCCCAACCTTTCTTCACGGCGCTCCGCCGACCACCGAAGCCGATCTCCGCGCCGAGCTGCCGCCGAAATCGACCGTTCTC
ACCCTCTGTGGTCGCTACTTCAACTCTATGGACAACGCGGTCAACATTATACACGCACCCACCTTCAACGCCCAGCTACG
CAGCCATTGGCAGGACCCGTCCAAGACACCCATCATGTGGCTGGGCCTCTTGTACTCTATTCTCTGCCTGGCAATGCTTA
GCTACCACAAGGTTGGCGACGAGCCGCCGGAATGGAAGGGCCGTGCTATGGAGCTGGCGGCGCTTTTTCGAGTCCGCACG
GTGCAGTGCCTGGTCGTTGCCGATTACACAAAGCCGGTCGAGTACACGGTCGAGACCATGATCCTGTATGTCTTTGGCGA
GTACTCGTCTCGCTGGGACGCGGATCTGGGCCTCTGGCTGATCGGCTCCCTGATTACGCGGGTGGCATTTCGCATGGGTT
ACCATCGAGATGCAAAATGGTTTCCGTCCATCACACCCTTCCAGGCGGTATGATTCCCCGATGCCTGTAATTGTGCTAGA
AGATATCTGTGCTGACTGCCCGCCTTGTAGGAAATGAGAAGGAGGACATGGGCGCTGGTGCGTATGTGTGATGTCATGTT
CTCACATCAAGTATCGTTACCGAATATGATCTATGAGCACGACTGTGATACACAGCTGCCGCTCAACATATTTGACGAAG
AATTCGATCCAAGCACAAAGAAGCTACCTCCCCCGCGGCCGAGTTCTGAACCCACGCCCATCAGCTACATGATTGCCAAA
GTCAAGCTGTGTCAGGAACTGGGCAATATTTTGCAAGCAACGACACGCGTCGGAAAGCCGGTGTCTTACGACGAAATCAT
TCGTCTTGACAGCCGCCTGCGAGCTGTGAAGAATGAGCTACCACCACATCTGAAGCTGCACCCGCTGGAGAGATCACGGG
ACCCTCTGACTCTGATCATAGCACGGTTCAACATTGATATCCTATACCAGAAGATCATGTGCCTGTTGCACCGCAAATAT
TTGCCTCGGTCCCGGCAAAATGCTCGTTACGACCGTTCAAGGCGAGCCGCCATCGAGGCCTCCTTGGAAACCTTACACCA
CCTTCGCACACTCGCCAAGGAGTCCGAGCCCAGCGGCCGGCTGCGGTCGATCAAGTGGTACGTGTCGTCCATTGCGACAA
AGGACTTTCTGTTGCCGGCGATGCTGGTGGCACTGGAGGTCCGCTTCAACAATACAGCCGAGAAGAGCGGCGAGACTATA
GACCCACAAGTAGCGAACTTCTGGACGCCCGCGCAGCGCATCGAGATGCGGTCTGTACTGGAGACAACAAAGGAGATCTG
GCGGCCGCTCGCGGACGGCTCGATGGAGGCATTCAAGGCGTATAACATCCTGCGGGTCGTTTTGGAACAGATGGGCTCCA
CGGAGACGCCGCCCACGAACCCGTCCGAAGTGGTGCCAATGTGCAAAGATGTTCCGGCACTTGGCGCCAACCCGACACCG
CCAGACTCGTGTCTGGAAACGCCCGGCAACACACAGCTGCCGCCGCCGCTCGAATCCGATATGATGGCACCGCTCGGTCT
TGCTCCGACAGCCGGGCCTAACCTCAACGGCTTGTTCGGGACCTCGATGCAGAGCCCAGAGGGAGTGGCATACGGCACAA
TGGACGCAACAATGGGCAACGAGCTCGGTGGCACGGACTTGGCACCACCCGAATTCCAAGGCGACTATCTCAGCAGCATG
GCTACCTTCAACTTTGCCGCCCCAGGTCTCGCTTATCCCGGCACGTTGGTGGATGAAAGCATGGACTTGACATCCAACTT
TGACTGGGTACGTTCCGGTGATCGCGTGGAGAGAGTTAATATAACAAGTTATGCTGACCTTGGAAAGGATACGCTGCAAA
ACTACGCCCAATCCGGGGCTTTTGCTGGAGATCCATCCTTCCAGTTCTTTCCGGGCAGCTCGGAAGTGCCTGTTCCAGGG
TCGGCAGAAGCTGACGCTAACATTTTTTTTGGAAATGTGGACTTGTCAGGTACAGGACCGGGCTCGGGCCCCAATACAGG
CTGATGCCTTAAGAGTGCTTTGCCTACGTGTTGGCAGTGTAAGAATGGGATTCAGGGTATGTCTAGAAACAGGACATACG
AGAATATACCCTTGTGTGTATACATGAAAGCAATGAGGGGGTACCTTCTGCGATATGGTTTAACAGGCGGATTTGCACGG
CCTGTTTTCTGTCCTCGGTTTGGCATAGCCGTGTGTGACGAGGACAACAAGTAATTAGCAACACCATCCTCCTGTATTGA
TAGGAAAATACCCTTCTCAATATATGCTTAAGCACGATTCACTTATGGCACTAACAATAACGTTGTCTTCGTATCTCATA
GTGTGAAAGTCCGCCAATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62