GenePrediction:GLEAN_8199 Details

Name: GLEAN_8199
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:403952..401411 (- strand)
Length: 2542
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:403952..403769 (- strand)
Length: 184
Type: CDS
Source: GLEAN
Position: GCSC_113:403705..401706 (- strand)
Length: 2000
Type: CDS
Source: GLEAN
Position: GCSC_113:401660..401588 (- strand)
Length: 73
Type: CDS
Source: GLEAN
Position: GCSC_113:401535..401411 (- strand)
Length: 125
>GLEAN_8199 class=GenePrediction position=GCSC_113:403952..401411 (- strand)
ATGGCTTCTCTCAACCTGTCGATCAACGGTCCGTCAATTCGGAGCAGCTACGAGTCCGTTCTCAACAGCACAAAAGCTTC
GGCACCGGCACACTGGGCCTTGTTCTCGGTCCAGGCACCACTTCTCAACGCGTTCCAGAACTCTGGTGCCAAAGAGAGCA
TTCTCAAGGTCGACGGCACTGGATGTGTGTATTTCTTGTTTGTCCGTTCTGGTGACGTTGTCCTTGCGGCAAGCTGACTG
TGAACAGCGGGCGAGCTAGAGGAGCTGGTCGAAGACCTCAACGACGGCCGCATCCAATTTGCCTTTGTGCGCGTGCAGGA
CCCCAACAGCGGCCTTCCAAAGAACGTACTGATCGCCTGGTGCGGCGGCGGCGTGCCGGAGAGAACAAAGGGGTACTTTA
CCAGCCACCTGACGGCCGTGTCCAAGATCCTCCACGGCTACCACGTCCAGATCACCGCCCGCTCGCAGGAAGACGTCGAG
ACCGAGAGCATCATGAAGAAGGTTTCCGACGCTTCCGGTGCCAAATACACGGCCGGCGGCTCTGGCCCGGCTTCTTCCAG
AGGTGGACCACCTCCGATTGCCAAGAAGCCAGTCTACACACCTACGAGCTCCTCGGCGGCAAACCCGCTGATTGCCGCTC
GCAACCGGCGACAGGAGCACGTGGACGAGGATGGTTGGGGGGCTGACGCTCCTCAGATCACCCGGACTCAGCTCGAGAAG
GTCCAGTCTGCCTACAAGCCGACCAAGGTCAATCTTGCCGAGCTCACGAAGCAGCACCAGCCCGAACCGGCACCGCGTTT
TGCGTCCAGCAGCAAGCCAGCCGGGGAGCACGGCGTCATTGGCGGCGGCTACCGCCCGGTCGGAAAGGTCGACATTGCCG
CCATTCGTGCTTCGGCCAAGAACAAGGAAGACGAGCGACCGACCATCGTCAAGGGCGCCTACGAGCCGGTGGGCAAGGTG
GATATTGCGGCCATCCGCGCCAAGGCACGGACTGAGCACGACGACCGCCCGGTGGTTGTCAAGGGTGCCTACGAACCGGT
AGGCAAGGTCGACATTGCGGCCATCCGGGCCAAGGCTCAAGTCCCTCACGAGAGCGACGAGCCGGCAGTCGAATCGCCGA
CGCCAAAGTCACTCGCCGACCGGAGCGCTGCCTTCAGCGGGTCCCAGGATGCGGAGCGGATAACGTCTCTCCCCAAGCCC
AAGGTGGCAAGCAAGTTTGCCGGCGCGTCTTCGTTTACCGGCACCAAGGCACCGACGCCTGGTGGCCTGGGTCTCGGCGC
CGGAGCCGCTCCCATTGCGCCGTTGGTAGGCAACGCCAGCCGCACATTTGCCGACAAGGGTGGCAAGACGCCGGCGCAGC
TGTGGGCCGAGAAGAAGGCCAGGGAAGGCGGAGGCTCTCACCCCTCGCCGGCACCGACATCTCCGCAGGCATCGCCGCTC
TCGTCTCAGAAGAGTGGTGGCGAGTGGAAGAGCGGCTACAAGGGCAAGAGCTGGGCGCCAGTGCCGACGAGCAGCTTTGG
CCACGCTGCCATGACCGAACAGAGGACGGGAGAGTCGCAGTCGGAAGAGCCGCCAGCAGAGCTGACCAGCAGCAACACTG
GAGGCGTTTCCGCGCTCCGTGACCGTTTCAAGGGCACCCAGCCCATCGGCCAACATGTCCCGTCGGCCTCGGCCATCTCT
CACCACGAACAACAGTCGCGGGACCTGCACGAGGAAGAGGACAGTGCACCACCGCCACCGATTCCCTCGGCTTCCCGGCC
GTCGGGAGGCTTCCAGCTTCCCGGGCTTCCATCGCGGCCGCCACCGGCTGAGGAAGAGGAGGTGGAAGAGTCGCATGAGC
GGGAACAGTCGCCCATCCGACTGCCTGTTGCTGTTGCCCGTGCTCCCTCGCCAGAACCGGAGCCGGAACCGGAGCCGGCG
CCGCCACCGGCTTCCCGCCCTGTCCCCGTGCCGACGTACGAGGAAGAGGAAGAGGAAGCGCGGCCAGCAGAACCAGAGCA
CCACGCTGCTGCTGCTGCCAGTGGACTGAGTGCCCTGGTTCAGTACAGCTACGAGAAGGCCGAGGACAACGAGATCGAGC
TGGTCGAGGGCGAGTATGTGGCCAACATTGAGCAGGTCGACGCCGACTGGTGGATGGGCACCAACTCCCAGGGCGAGACC
GGCCTGTTCCCCAGCAACTACGTGGAGCTCGTGACCGACGATGCCGAGCAGCTGCAGGAGGACGTGGACGAGGGTCCGGC
AATCGAGGTGCACCCGCCGCCGCCGCCGCCGGCCGCCGAGCCAGAGCCCCAGGCTGGTCACGCCGCCGTCGAGGAGCATC
CTTGGGCGATTGCCGAGTACGACTACGAGGCTGCAGAGGACAACGGTAAGCACCCGTGGTCCCATGTCCTGTTGAGATAC
GTATGCTGACAGAACAGAACTGAGCTTTCCCGAAGGCGCACACGTCACCGGCGTCGAGTTCCCCGACGACGACTGGTGGT
TCGGCCACTACAACGGCCAGTCGGGTCTCTTCCCGTCCAACTACGTCCAGCTGCAGCAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62