GenePrediction:GLEAN_819 Details

Name: GLEAN_819
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:225883..227106 (+ strand)
Length: 1224
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:225883..226065 (+ strand)
Length: 183
Type: CDS
Source: GLEAN
Position: GCSC_132:226138..226202 (+ strand)
Length: 65
Type: CDS
Source: GLEAN
Position: GCSC_132:226335..227106 (+ strand)
Length: 772
>GLEAN_819 class=GenePrediction position=GCSC_132:225883..227106 (+ strand)
ATGGACTCTCCCCTCCAACAGGCTAGCATCCCCATCATCGACTTTGCGCCGTTGCTTAGCGGCCGATCTGACGATGCTGC
AGCCGTCGGTCGAGCTGTCTACGAGGCATTTCGAGACTTTGGCTTTGCTTATCTCAGCAACCATGGCTTTCCTCAGGATA
CCATAGACGAGGCCTTTAGCTGGGTACCAAGACCCGAGACCCCATGTTCATTGAACTAGTAGCTGTTGGCATTAGCTAGC
CACTAACGTCACCAGAGTGCCAGGTTCTTTGCTCTTCCCCAGGCCACCAAAGAAATAGCCCCACATCCACCACAAGGCTG
GTGGCATCGTGGATACTGATGAGGCGAAGATCGTTGTATTCAGAAGGAAGACAGCTATCTGAAGCTAGAGGAAGTCTGGG
CTGAAAACTCTGCACTAGAGGTGGTCCGTGCACCACCGCGCAACAGATACAGCGGAATTGGCCGCGAGAAGCTCAGTCAG
ATGGTTTTCGACCACGCCGCCATCGGAGAACTGCGCAAGGTTCCCGACTACAAGGAGTTATTTGAAATGGGGCGGGAAGA
CGATATCGCAATGCCCAATATCTGGCTGCCGGAAGAGATGCTGCCGGGCTTCAAGCTGTTCTTTCTAAAGTTTTACGAGA
AGTGCTACGTGCTAGAGCTGCAGTTGCTTCGCGTCATTGCGTTGGGAATGGGCCTGGATGGACGGTATTTCTGGAATTAC
CACACGAACAAGGACAACCAGATTCGCCTGCTGCATTATCCTCCAGTAGAAGAGGCCCATGTGCGACGCGGGAAGATGGA
ACGCTGTGCAAGCCACACGGACTATGGTACGATGACACTTCTGTTCCAGGACACTGTCGGTGGCCTCGAAGTCGAGGATA
TCCACGAAAAGGGCAAGTTTAATCCCGCACCGCCCGTACCTGGAACCGTTTTGGTCAACATAGGTGATTTTCTGCAGCGA
TGGAGCAACGACAGTCTGAAATCTACACTACATCGTGTGCGAGCACCGCTGCTATCTGAGAATGGCATTATGAAGACTGA
ACAAGAGGCTTATGGAAATGGAAGAGTTACCCCTTCACGCTATTCGATCCCATACTTTGTGTCAGCAGATCGTGAAAAGG
TTATCGACTGTTTGCCTGGCTGCTCTGGCCCTGATAAACCGAAAAAATACGAGCCCATCAATAGTGGAGATTACATGGCT
ATGCGTCTGAACGCTACGTATTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62