GenePrediction:GLEAN_81 Details

Name: GLEAN_81
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:525241..525900 (+ strand)
Length: 660
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:525241..525450 (+ strand)
Length: 210
Type: CDS
Source: GLEAN
Position: GCSC_179:525517..525743 (+ strand)
Length: 227
Type: CDS
Source: GLEAN
Position: GCSC_179:525888..525900 (+ strand)
Length: 13
>GLEAN_81 class=GenePrediction position=GCSC_179:525241..525900 (+ strand)
ATGCGGCTTACGATCGCACGCCAGCTGCAGGTGCTGATCCGGCGGCCGGCTCCCGCATGGACGTGGCCGTTTTCGTCGGC
CGCTGCCGCGCCCTTTGTCACCTCGGCCTGCCGGGCGATCAAGCCCATGCCGCCTCGGCCGCCGCCGCCGCCGGAAGACG
AGATCGAGGAGATGTTTGTCAAGGGGACAGGACCAGGCGGACAAAAGATTGTAAGCTTTCTGGCTGCTGTGGCTCTCTCT
GTCCCGGACCCCTTTCCCCGCTGACCTCTACTGCAGAACAAAACCAACTCGGCCGTCCAGCTGATACATCGGCCCACCGG
CATCGTGGTCAAGTCGCAGGCGACACGGTCGCGGTCGCAGAACCGCACGATTGCGCGACAGGTTCTGGCCGCCCGGCTGG
ACGAGCTGCACAACGGCAGCCAGAGCCGTACCGCCATCGTGGCCGACTCCAAGCGCCGGAAAAAGGCGAGCGCATCCAAG
AAGAGTCGCCGCAAGTACCGCCAGTTCGATGGCCAGGAAGAGGGGCAGAGAGAAGAGGGGAACGAAGGAGACCAGCAGCA
GCAACAACAGCAACAGCAGCAGCAGCAGGATCCCAACATAGAACAGGACAGCGAAAATCCTTCTGCAGCTTCTCTCCCTC
TTCATAGCACAAATGCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62