GenePrediction:GLEAN_8201 Details

Name: GLEAN_8201
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:393124..391784 (- strand)
Length: 1341
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:393124..393119 (- strand)
Length: 6
Type: CDS
Source: GLEAN
Position: GCSC_113:393044..392990 (- strand)
Length: 55
Type: CDS
Source: GLEAN
Position: GCSC_113:392927..392025 (- strand)
Length: 903
Type: CDS
Source: GLEAN
Position: GCSC_113:391956..391784 (- strand)
Length: 173
>GLEAN_8201 class=GenePrediction position=GCSC_113:393124..391784 (- strand)
ATGTCTGTAAGTCAAGGTGCTCTACAGCCCTGCATTTACGAGCTTGTCCGTCCGGGATGCTAACGTGCTCTCTGCCACAG
TTCTATATCGAGAACAAGAATGTTGGTAACCGGTCAGACAGCGAGGATTGGCGCAGTAAGCCACCCCCGGCAGCCCAGCT
CGGGCCAGACTGCTAACGGAAGGTCCTCGTCGTCCAGTTCGCGGATACAACCCGTTGACGCCACCGGACCTGCTCCAGCA
TGAGATCAAGCAGACGGCCGAGTCGAAGCAGACGGTCCTCGGCGGTCGGCAGGAAGCCGAGGCCGTGGTCAACAACGAGG
ACCCGAACCAACGGCTGCTCGTGATTATCGGACCCTGCTCGATCCACGACCCCGAGGCCGCGCTCACGTACTGTGACCTG
CTGCTGGCCGAGAAGGAGAAGCACAAGGGCGAGCTGCTGATCGTGATGCGGTCGTACCTGGAGAAGCCGCGCACGACGGT
CGGCTGGAAGGGCCTGATCAACGACCCGGACATCGACAATAGCTTCCAGATCAACAAGGGCCTGCGGCTGTCGCGCCAGC
TCTTTGTCGACCTGACGAGCCGCGGCATGCCCATCGCCAGCGAGATGCTCGATACCATCTCGCCGCAGTTCCTGGCCGAC
CTGCTGTCGGTCGGCGCCGTCGGCGCGCGCACCACCGAGAGCCAGCTGCACCGTGAACTGGCCTCGGGCCTCTCCTTCCC
CGTCGGCTTCAAGAACGGCACTGACGGCACGCTCGGCGTGGCCATTGACGCAATCCGCGCCGTCAAGCACCCACACCACT
TTCTGTCCGTGACCAAGCCTGGCGTCGTGTCCATCGTCGGCACCGTCGGCAACGACGACTGCTTCGTCATTCTCCGCGGC
GGCACCAAGGGCACCAACTACGACTCCAAGAGCATCGCCGAGGCCAAGGCCGCCCTCCAGGCCGCCGGCATGCCCCAGCG
GCTGATGGTCGACTGCAGTCACGGCAACTCGCTCAAGGACCACCGAAACCAGCCAAAGGTGGCGGCCGAGCTGGCCAGCC
AGATCAGCGCCGGCGAGACCGCCATCATGGGCGTCATGATCGAGAGCAACATCAACGAGGGTGCGTCTGATTATCTGTTG
GCTCCTGTCCGTCCATTCGACCGTCTGCTAACTCGTCCGGGATCACAGGCAACCAGAAGGTGCCCAAGGAAGGCAAGGCT
GGGCTCAAGTACGGTGTCAGCATCACCGATGCCTGCATACATTGGGATGACACCGTCAGTGTGTTGGACGTCCTTGCAAC
TGCTGTGAAGAAGCGGAGAGAGATCCTGGCCAGAGACACCACAGCGGCAGGACGATCCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62