GenePrediction:GLEAN_8202 Details

Name: GLEAN_8202
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:391306..389995 (- strand)
Length: 1312
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:391306..391232 (- strand)
Length: 75
Type: CDS
Source: GLEAN
Position: GCSC_113:391061..390895 (- strand)
Length: 167
Type: CDS
Source: GLEAN
Position: GCSC_113:390795..390733 (- strand)
Length: 63
Type: CDS
Source: GLEAN
Position: GCSC_113:390661..389995 (- strand)
Length: 667
>GLEAN_8202 class=GenePrediction position=GCSC_113:391306..389995 (- strand)
ATGTTGGCAAGGTCCTGCCTGCGGTCAACGCGGGCCTTTGCCGGCGCCCGCCCGAGTGTCTTTAACGTGGCCAAGGTAGA
TTGATTTCCTCTCCATTTTCGTCTCTTGCTTTTTATGTCGTCCTCATTTCCCCGATGCAGCGGCTTCCGGCCGCGGTCTT
GCCCGTCTCTGCTTGCGGCCTCTGATGTGTCTGCCGTGCTGCCGGTCCGACGAAACAGTCAATTGACTTTTTTTCTCTTC
TTCAGCGTGCAGCCTCCACCTCGAGCTCCGGTTCTGCCGCCGGCGATGCGGCTTCCAACCTGCGCATGAACGTTGCCGCA
GCCGCGTCGACCGCAGTGGCCGTCGGCTCGGTTGCCTGGTACTACCACCTCTATGGGCCCGTCGCCCAGGCGATGACCCC
TGCCGAAGAAGGGTAAGTGCACGGGCTGAGCAGATGGGCGAGGGATTTTGCGAGCAGCCGACAGCGAAAAGGAAGCTCCG
GATGGGCTGGAAGATGCTGACCTGCCTCTAGTCTGCACTCCACCCAGTACCCCTGGGCTCACCAGGGCCTTCTCAAGACA
TACGACCACCAGGCGTAAGTGCCCCCTTCGAGATGCGCTGCCGTGTGCTGCAAGCCGTTGCTGACGTGCGGCTGTCGGTC
TCCAGTCTTCGCCGTGGTTTCCAGGTGTACCGGGAGGTCTGCGCGGCCTGCCACTCTCTCAGCCGTGTGCCGTACCGCAC
GCTCGTCGGCACGATCCTGACGTCGGACGAGGCCAAGGCCATGGCCGAGGAGAACGAGTACGACTCGGAGCCCAACGACC
AGGGTGAGATCGAGAAGCGCCCCGGAAAGCTGTCGGACTACCTGCCGGCGCCGTACCCGAACGAAGAGGCGGCGCGGTTT
GCCAATGCCGGTGCTCTGCCGCCCGACTTGAGCCTGATCATCAAGGGCCGTCACGGCGGCTGCGACTACGTCTTCTCGCT
GCTGACGGGCTACCCGGATGAGCCGCCTGCCGGCGCGCAGGTCGGTGCCGGGCTCAACTTCAACCCCTATTTCCCCAACA
CCGGTATTGCCATGGGCCGTGTTCTGTTCGACGGCATCGTCGAGTACGAGGACGAGACGCCGGCGACCACGTCGCAGATG
GCCAAGGACGTCGTCGAGTTCCTCAACTGGGCGGCCGAGCCCGAGATGGACGACCGGAAAAAGATGGGCATGAAGGTGCT
CGTCTCCACGACCATACTGTTCGCAATCAGCGTCTGGGTCAAGCGGTACAAGTGGGCCTGGCTGAAGTCGCGGAAGATTG
TGTACGACCCGCCCAAGAATGTCGGCCACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62