GenePrediction:GLEAN_8204 Details

Name: GLEAN_8204
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:382895..376258 (- strand)
Length: 6638
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:382895..382889 (- strand)
Length: 7
Type: CDS
Source: GLEAN
Position: GCSC_113:382805..382177 (- strand)
Length: 629
Type: CDS
Source: GLEAN
Position: GCSC_113:381675..380392 (- strand)
Length: 1284
Type: CDS
Source: GLEAN
Position: GCSC_113:379977..377605 (- strand)
Length: 2373
Type: CDS
Source: GLEAN
Position: GCSC_113:377529..376258 (- strand)
Length: 1272
>GLEAN_8204 class=GenePrediction position=GCSC_113:382895..376258 (- strand)
ATGCAGGGTGAGTCCAGGCCGGTTGCTTTGTGTGTCTTGTCCATTATTATGTTCTAATTGTTGGACTAACATGTGGCGGC
TGCGATGAAGATGCTGTATCTTTCCCCGACTACCACTGCTTCACATCGAACCAGACTGGAAACACGGTGTTTCTGATGCT
CGCCATCGTCATCCCCCGGTTCAACGGCGAAATGTTCTTGACTGCCAACATTGGCTGCGCACTTGGCTTCTTCCTTCTCG
CCAGCTGCCTGACTGGACAGCTGGGCCACATCATTGGACCGCGGTGCCGACTCTGGTTGATAGGGTGCAACCTCTTTCAA
GCATGCCTAGTGTTTGCCGCAGGCGCCATCCAGAACGTCTATAGCGTCCAGGTCGAGGGTACTCGTGCTCTCGTCGTCGT
TGGCCTACTTTCCTTCGCAGCTGGCAGCCAGGTTGTGCAATCCCGCTCAATGGCCATGACCGAGATCAGCACAGCTATGG
CCACGGCTGCATGGGTTGACCTGGTCATCGATCCGAACTTGGCAGTGCTGAACAACCGTCCTCGGACTAGGCGGGTTGTG
TTCCTTGCCTCGTTAATCGTGGGTGCACTGCTTGGTGCAGTCATTTATCGCAACGTTGGGTCGTCTGTGGCCGTACTGAT
ATCGGCTGGAGGTAAGGTGCTCGTGGCTTTGCTATACCTCTTCAATGAAGCGGAAAAGCCCAAGGTGGATGCTGAAGAGG
TATGACCTGCATCCTGTATTGGGGATGTTTTGGTTAAGAGAGCAGCAACTAGAATTAGTGTCTTTACTGTTTACGATTTC
ACGGATGATACACGAAGCATGCGATGACGATTGGGCGTTCTCTATCTGATAGATTTGTTTAAGCAGTTCCCAATAGAACG
AAGTGTAATTTTCGCCGACATCTACTTTAGTTGTGACCATGCAAGAGGTTGTGGCCAGAAAGGGAAGGTTGCCTGGTGGG
GCCACATCTATTCCACGGACGGCTGCCACCTGATTACGCGACGCTGGCTGCTCGACGCGTTTAATATGGCGGGTCGGAGA
AAAACGCCACCGACCACTCCTTCCGCCTATGCGCATTGCCTATGACCACAAACGCTGCACGCATAAAAGTAGAATAGCAG
CCAAATCCCGATCTGCTCATTTCTCAAGCCAGGCTGCTGTGCAGGAGGACCGCAATTGCAGCTGCGTCCAGCCACGACAG
AAGCTCATGACTGCGGGCAGATAGCGGAACGTCTGTTCCTCGATACGGCCTTCATGACGATCAACAATCTTGCCGAACAG
CTTCCTTGGCTACTGCGAAATCTCCAGGCCACTCATCCTGCGATTGGCTCTTCGTCTCGAGGAGCTGGACCCGGGTTTCT
GGCTACGCCCACCTCTACGGCCAGCCTTTCGACCGCTGCCGTCCTTGCGTCGTCTTTCCGGAAAGATGCCGTCGTGTCCG
GCAGTTCGACCGCGGTATCGACACTACCACGAGGCGCAGACCTTGGGCTGCCCACCCCTACATCTACTATATCGTCCTTT
TCGGCCAGCTCGCGACCGACACCAACCATGCAGCCGTACGGCGGAGACGCAAGGCCACCGCCGCAATCTGTGGAGAAGAG
GGTGCCCAAGGTGTCCAAGGTGCCTCTGCCGCCAACGGCGTTCATGACCCCTGGGCCGTCTGCGGTTCAGGCGAAAGGCG
GCCTGACCATCGTGGATGCCAAGGGCAGGATAAAGACCACTGCAGTGGCAAGCGTTAGGACTCCGAACAAGACGCCAGGA
TCTGCGACACAGACGCGCAAGGCCAAAACACCAGTCGCTCCGTCTCCGTATGCGCTCGACTTTGGCTCCGATCTTGATCT
GGACGACTTTGACTCCATTGTCGACCTGACCGGAGACGAAATCAACACGGGCTCTTCTTCTCCGGGCGGAGCTCCGCGGG
AGGACACACACATTTGGCGAGAGGACTACTCGGCAAGGCCGGGTTCCGTCTCAAGACGCGGGAAGAAGAGGAAGAGTTGC
GATATTAGCAGTACCCCTTCCAGAAAGCCCGCGACTGAGAAGAGCAAGGACGTAGAAACCGTCGACGACGGCAATGCCGA
TTTTCCAGACATTCATGATCTTGTGGGCTTCTCATCGCCCACCACGCCGCGGTTATCACCACCACAGAAACAGACGGAGC
AACTGTCGGTAGTCCGGGAGCCCACACCAACAAAGAAACAGAAGTGCCTGTCGAGCCGCAGCGATGTGGTAATGGACTCA
GAGGACGAGTTTGTCACCCCGCCGACCCGCAATGCCTCGTTTGTGGCCTCGCTGGCAAAACCGGAGAAGCAAGATGGTAG
TGTTCCGAAACCTTGTTCCCCCAATATCAAGACTGCTTCGCATGTAGCAGACACTCCATTACGAAAGACGGCAGAGCGAC
ATGCACCGATACCGCCAAATACAACCAAGAAATCGGAGGTGGGCACTAGCGCAGATATCGATATGCAGACCGGAGATGAG
AGTGTTATCATTCAAGAGCCGGCAGTAGGCTGTGGCGATAGTACAATCGGAGGGGAACGTTCTGCCGACAAGGACAAGCC
AGCACCGGCTCCAGCACCGGCTCCAGCACCGGCTCCAGCACCGGCTCCAGCACCGGCTCCAGCACCGGCTCCAGCACCGG
CTCCAGCATCGGCAGAAGACGACGATGACGAAGATATGGAAGAGACACAACGACCAAGTATTCTCTCGTATTGGCCGGCG
TTGAGATGGAAGCAGCACTTGGTCGAGGAGAAGATACGAAATAACACAACCGAGTACACAAAAGCCCTTCGGGAAAAATG
GCCACAGGCACGCCGAATGCAAATCAAAGGAGAAAAGGAACCTATTTTGAGGGAGAAGCAGCCGTTAGACAGCCTTGTCG
ACGAAATGAGGGCCTTTGCCCATCTGTATAATGAACAGGAGGCTCTGCTTCATTCCATCACGGAGGCGTACCAAAATCAT
CTCGACACCGAATCGGAAGAGTCTCGCCTAGACGACCTGAGCCAGGAACTCCAGGACCAAGAAGAGACCCTTCGCACGCG
CCTCTCCGAAGCAGCAATCGATCCTTCCAGCTGTCCGCGCGATTTTGATGCCGGCAGTCCCAATAGTGTTGTCATTCCCG
CGACCCAGCACCCAGAGGGATTTTCGACGCCCATGACAGGCCGCAGCAGCACCTTTGCTACGAACCACTCTCAGATCATA
CTCCAGACGCAACTTCCACCACCGCAGCAACGCAGTAGACAAGCTGCCGACGGATACGACTCGCCCAATGGCCATCTGCC
AGCAAGAATACACACAATACCCCGAGCAGCAACGACCCGAGATTCTGATGCCAAATTCCATAGTCAAGGAGACTACTTTG
ATGACGACGACATATTCAACGAGATGGAGGACCTCCCATCCATACTTGGTACAGGCTTTTCCGGTTCCGGGTACGGTGCC
ACGCCAGCCTACGGGCCTGCGGGATCAACGAACACTGCCTCCAGCAGACGAACCCCCCATAAGCCTCCTCCGGCAGCGCG
GGGGCAAGAGTTCTTCAGCGATTTCAGCGACGATATCGAGATGCTGCAGGTGGCGGAGAGCTTTGAACAGCAACACTCGT
TTAATGCTGGGTCGACGGCAAGGCCTGGGCCTTCGCGGACAATCCTCACACCGGCGTCTGGAAACGCGAAGAAATCACCG
AGGATGGCTTTGGGCGGTGCCAAACAAGCGAGTCAGCTTGCGAAGAAGCCGGCGATCCCCCTCGAGCTGATGTGTTTTGA
CTGGTCGCAGGAAGTGCGCAAGGCGCTCAAAGACCGATTTCGCATGTCTGGCTTCCGGCACAACCAGCTCGAGGCCATCA
ACGCCACGCTTTCCGGCAAGGACGCCTTTGTGCTCATGCCAACGGGAGGCGGCAAGTCGCTGTGCTACCAGCTGCCGGCG
GTCATCAGCAGCGGGAGGACAAATGGGGTGTCGATTGTGGTCAGCCCGCTGCTCAGTTTGATGCAGGACCAGGTGGACCA
TCTCAAGGCCCTGAACATTGCGGCGAGCGCGTTCAACAGCAGCACGCCGGCAGCTGCTCGCAAGCACATCCTTGCATTGT
TCTCGAAGGCGAACCCCGAGCATTTCCTGCAGCTGCTCTACGTCACGCCAGAGATGGTGAGCAAGAGCAGCCAGTTCTGC
CAAGGCCTGGAGACGCTCTATCGGAAGAAGAAGCTGGCGCGGCTCGTCATCGACGAGGCTCACTGTGTCAGCCAGTGGGG
CCATGACTTTCGGCCGGATTACAAGGCGCTCGGCGAGGTGCGGCGGCGGTTTCCCAGCGTGCCGGTGATGGCCTTGACGG
CGACGGCGACGCCAAATGTCATTGTGGACATCAAGCACAACCTGAGCATCGACGGCTGCAAGGTGTTCAGCCAAAGCTTC
AACCGGCCCAACCTGTACTACGAGATCCGAGAGAAGGGCAAAGGCGCGGTGGAGAACATCGCCGAGCTCATCCAGTCGCA
GTACAGCGGCCAGACCGGGATCGTGTACACGTTATCGCAGAAATCGACGGTCAGCATTGCGGACAAGCTGCGAGACAAGT
TTGGCATCTCGGCGCACCACTACCATGCCGGCATCCCGGCCGACGAGAAGACGCGGATCCAGCGTGACTGGCAAAAGGGA
CGGATCAAGATTGTGGTGGCCACGATCGCCTTTGGCATGGGCATCGACAAGCCGGACGTTCGGTTCGTCATCCACCACTA
CCTGCCGAAGAGTTTGGAGGGATACTACCAGGAGACCGGGCGAGCGGGCCGGGACGGGATCCATTCGGACTGCTTTCTCT
ACTTTAGCTATGGCGACATCAAGAACCTGCGCAAATTTATCGCCGACTCGGAGGGCAGCGAGGCTCAGAAGGCGCGGCAG
CGGGAGATGCTGAACCGGATGGTGGATTTCTGCGAGAACAAGCGCGACTGTCGGCGGTCGGAAATCCTGCGCTACTTTGG
CGAGAACTTTGAGCAGAGCGGATGTGGTGGGACGTGCGACAACTGCAAGTATGGCGGGAAGTTTGACCTGACCGACTTCA
CGCAGTATGCGGTGGCCGCCCTCCGAGTGGTGGAAGCGTACGAGCTGATCACGATGATCCAGTGTGGCGATATTCTGCAG
GGAAAACGGCGGCCTGAACCGGAGCATAGCTCGCTGCAAGAGATGTATGGGATTGCCAGGAATCTGAAGAAACATGAGAT
CCACATGATGATCTACCGGCTTCTGGGAGAGGGTGCCCTGAAGGAGGAGAACAAGGTCAACCGGATGGACATTGCGATCC
AGTACTTCAGTGTAAGCACCAGGCGGATGTTGGGAGAGCAGAAAGTGGCAGAAAGACAGAAAAGCAGAAGCTAACCGTGT
CTGCAGCTGGGCCGTCGCGCAGGCGAGTTCTTTTCGGGCACGAAGAAGCTACAGGTTGTCACTAAGGTTGGCACCGATGT
AGCCGGCCCGATTGCTGCTAAGAAGACGACGGCATCGAACAAGACAGGCAAAAAGGCTAAGACGGCCAAGGCGACTGGCG
GAGACGATTCAGTGTCAGGCCGAGCAGCAGCCAAGAGCAGTCGAAAGGGCAAGGCCGTAGCCGTCGCTCTCGACCAAGGC
GACGATGTCGAGGCAGATGGCAGCGACGCTGAATCCGACGAGTTTGGCGGTCCTCTGCACGCAAACGGGTATGCCAAAGA
CAACTTTGTCGTCTCGGACAACGACGACGACGATTTCGAAGAGGCTGCACCGCCAAGACATCCGGCACAAGCACAACGCA
AGGCCCGGAAAGTCCAGCTGGACCGATTCCGGTACGAGAACCAAGGCAGCAGCAACAACGTCATCCGGCCACCACAGCGG
CAGCGCAGGCTGGAAGAGCTGGGCGGACCGATTGCACATGACTCGCGGTTGACCGAGGCCAACATCGACCCGATTCATGC
CGACATCATCGCAGCCTTTGCTGACGAGGCACGACGGATCGAGGAGAAGATTCGGAACGAGAAGGGCCTGCGGATCCTGT
TTACCGAGAGCCATTTGCGCGAGATGGCCATCGGCTGGACGGACTCGCTCGACAAGATGCGGCGGATCCGGGGCATTGAC
GAGGGTCACGTGAAGCGGTACGGCGGCCGGTTTGTGCAGCTGATCAAGCGGTACCAGGTCATGTATCAGGAGATGATGGG
CTTTGGCCGCGACGAGAGCCCAGAGCGGCCGATAGCGACAACGACCGTGTCGGCTGCTGCTGCTGCTCGGCCTTTGCGTC
GGGACTATGAGGCCGTGGTAGACCTGATCAGCTCAGACGAGGACGAGGACGACAAGGACGACAAAGACGATGAGCCGTCG
GTGAGCGAGTCACGTGAGGCTGAGCGTTGGCGGATGGAGCTAGAGACGCTGCAGACGCAGCCATCAGGCAAGTCTGGTGG
TGGTGGCGGGCGATCTGGAGGAGGCTCTCGCAAGAGCTGGTCGTCTGGCGGAAGTCGAAAGCCACCTCGTCGTGGTGCAG
CCGGTGGAGGCGGTGGGAGCAGTCGGGGCGGAGGCGGAAGCTCAAACTCACGCAGCCGCACAAGTGGTGGAGGAGTATCG
AGACGAAAGGCCCCAGCTTCAGCTTCAGGCTCGGCTTCGGCTGGCGGACGAGGCGGCATTGGCATGATGCCTCTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62