GenePrediction:GLEAN_8206 Details

Name: GLEAN_8206
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:365609..364972 (- strand)
Length: 638
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:365609..365601 (- strand)
Length: 9
Type: CDS
Source: GLEAN
Position: GCSC_113:365530..365454 (- strand)
Length: 77
Type: CDS
Source: GLEAN
Position: GCSC_113:365386..364972 (- strand)
Length: 415
>GLEAN_8206 class=GenePrediction position=GCSC_113:365609..364972 (- strand)
ATGTTCGAGGTGCGTGCTGGCATAATCTCTCTTCACCATGTAACGGCTTTAACATACACTCTGACATGCATCATCGCAGG
CTCTGCAACCGCACCCAGAGGATCACCTCCAGCTACGTCTTCACCGCGCCCGGTCTGTTATTCTGACTTCTGATGAGTAG
GTCGGCCTTTTATCTCACTCGTGCTCCCTCAAGCCATCTGACCCTACCCCACTCATGATGCAGGCTTGTTGAGATTCGTG
CTGCTCAGCGTACCTTTGAAGGCGCGTACATGCGCACGGCGCTGTCGCAGTTTTCATTTGCCTTGGTCGTGCTCAAGATT
TTCACGTCCGAGTTTTATGCAATTGGCGCGCTCTTTGCCGTTTACGGCGCAGCCGTGATGCTTGTAGCTATCTACCGGCG
ATATGAGGGCAACCGCCAATTCTTCAACACGGAAGAAGAACTAAAGGACGTCATCCGGGAATCGGGCTCCAATGCCGGCG
TTGAGGCTCCGAATCCAGGCCGCCGACCCAGCATATACAGCAGAGTAGTGACTAAGAAGAAGTTCCGCACGAGTGGTAAT
AGCGTGGCTTTACTAACCGTGCTGAGTCTCTTTGCACACATTGTGTTGCTTGTTCTGCTGCACCGGTTACAGGACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62