GenePrediction:GLEAN_8207 Details

Name: GLEAN_8207
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:350144..349459 (- strand)
Length: 686
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:350144..349833 (- strand)
Length: 312
Type: CDS
Source: GLEAN
Position: GCSC_113:349757..349700 (- strand)
Length: 58
Type: CDS
Source: GLEAN
Position: GCSC_113:349644..349581 (- strand)
Length: 64
Type: CDS
Source: GLEAN
Position: GCSC_113:349525..349459 (- strand)
Length: 67
>GLEAN_8207 class=GenePrediction position=GCSC_113:350144..349459 (- strand)
ATGGCACGACGCAGCGCAACGACGGCAGCGGCCGGTTCGACAACGGCGACGACCAGCGCAGCCACGACTTTGACATCGAC
AACGACGACGACGACAACTACGACGAGTACGGCCACCACGACAACGCCCAAGGCTAACAGCGGGCCGTCGTCAGCGTCTT
CAGCGACGACGTGGAATGCCGTGCTCGCCAATGTGGTCAACTACTACCAAAAGGACACGCCGCAGCGGACGAAAATGCTG
GATGCCTTTTTGGCCTTCCTCGTCGTCGTGGGCGGGCTGCAGTTTGTGTACTGCGTCCTGGCGGGCAACTACGTATGTCG
GCGGCGACGGAGCGGGAGATGCGACACGGCTGCCGGAAGAAGACTGTGCTAACCGGCGTTCTCACAGCCCTTTAACGCCT
TCCTGTCCGGCTTCTCCTCGACGGTCGGCCAGTTTGTCCTGACCGGTACGAAGCGGCCTGCGTTTTTCCTTGATCCAGTA
CCTTACTGACAGACCGACAGTGTCGCTGCGCATCCAGACAACAGAGGCCAACAAGACGGACTTCCCGTCTGTGTCTCCGG
AGAGGTAGGACTGCTTGGTGACGGAAAGACGGTCGATTGCAACGCTGACCCTCGAACAGAGCTTTTGCGGACTACATTGT
GTGCAGCCTGATACTGCACTTTTTCTGCGTCAACTTTATCAACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62