GenePrediction:GLEAN_8210 Details

Name: GLEAN_8210
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:339611..331195 (- strand)
Length: 8417
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:339611..338698 (- strand)
Length: 914
Type: CDS
Source: GLEAN
Position: GCSC_113:338629..338467 (- strand)
Length: 163
Type: CDS
Source: GLEAN
Position: GCSC_113:337943..337631 (- strand)
Length: 313
Type: CDS
Source: GLEAN
Position: GCSC_113:337556..331768 (- strand)
Length: 5789
Type: CDS
Source: GLEAN
Position: GCSC_113:331293..331195 (- strand)
Length: 99
>GLEAN_8210 class=GenePrediction position=GCSC_113:339611..331195 (- strand)
ATGAGCGACTTCTCCTGCTACGGGGGTGCCAGCAAGGAATGGCAGGCCATTAAGGCCGTGCTGCCGCCCCAGATGCAACA
CCAGTCGGCAACGGAACACCGGGATGCCATCAACAGAGAGCGCGAGAAGATCACTGCCACCGAGTTCCAGGCGCTGGCCA
ATCTCGTCGACACAGCCGACTACCACATTGCGACCCGCGACGGCTCTGGCACCATCGGGGCGCGCTCCTACTGGCCCAAG
ACGGTCCCGCGTAACCCTCGACCGGCCATCTTTCTCTACATGCATGGCGGCGGCTATATGTACGGCTCTCTGGCTACCGA
AGATGCCACGGCTGCCCGGATTGCCGTTGGCGCCGGCGTCGTCGTTCTCAGCGTCAACTACCGCCACACACCAGAGCATC
CCTATCCGACAGCTTGGCTCGACTGCCAGGACGCCTTCCTCTGGCTACACGACAGGGCCACTGACCTCGGCATCGATCCA
CGTCGTGTCGTCGTTGGTGGCATCTCGGCTGGCGGCCATCTCGCCGCATCGCTCGTCCTCGAACAGCATCTCGGCCGACT
GCCGGGCGACAACGTGGCCGGCCACCGCCTGCCGCGCATCGCTGGCCAGGTACTCATGGTCCCCGCTCTCGTACACCAGG
ACTGCTACGGCGTGCTACAGTCCCGCCTCGCCAGCCCGGCCGTGTCGTCGCGCGTCGAGAACGCTGAGGCGCCCGGCATC
CCGTCCATCACCCTCCGGCTCTTCACAGACCTGCTGCAAGTCGACCGCCCCGACCCCTCCGACATCATGCTCAATCCTGG
ACTCGCTCATCCCAGCCAGGTGCGCGGCTTACCGCCCGCTGTCTTCGGCATCTGCGGCTTCGATCCACTGCGCGATGAGG
GCCTTCTGTACGCAAAGCTGCTGGTCGAGCAAGGGTACGTTGCGCGGGACTGCTGCGCTTCCTCTGGAACACCCCAGGTT
TTCCATACTGACAACCTGTTAGTGTTTCCACCGATGTCCATCTTTTCAAGGGTGTCCCTCACAGCTACCGGCGCTACGGC
AACTTGGCGCTGCATCAGGACTGGGACGACGTGCTGGAGCAGGGAATAATTTGGGCGCTGTCCGAGCCGTCTCCCACCGG
TGGTTTCCACGTCAATGTTCATGAAGTATGATGGCAGTGGTATCGCAGGCAAGATCTGTTTGTAAATGTCACGTGATTGC
GTCCTTCGCGATCTGCTTCAGTTTGAGTTGTTCCTGCCAATTGTGTAAGCGCCAGAACGCTAGCGGGAAGCTGCAGTCAC
AGACCCATTGTAATAACGCGCTATCATTGGCCAAAAGATTTGCGCCTTCACTAGCATCACTTCCCTCTCAGCTACTGGAA
ACAGTGACAGCTAAAAAAGGACAAACACAAAGGCATCAAAAACTACGACGGCCAGAGAGCATCGCCAATAATTACGCCAC
GGCACGTCGACATCCGATCGCCAACCTTCATCAACGCCGCTGTCGACTGTACCTTCTGTGTCTCATCTGATTTGCTTTCA
CCCCGTCGAGGACTGCTGCACGCGACGTCTTCTTAATGGAAGGTCAGCGGCGTGACAGCTTTTTCTGTTGATTGCTCCCA
ACCGCCTCTCCTTTCTTTCTTTCTCACCCCACCCCTATTTCCCACCGGACTTTCATATTCTGCTTTAGTATTTGTTTGGA
TTTCTCATGATGGCTGCGGCAGCCGTGGACGTGGGCTACTTGTCCTCGCACCTCGGCGTGCCCCAAACGAGCCTCTCCAC
CGCCCTGACCGAGCCGACCGTTGATCTGATCCAGGGTATCCTCGACGCCGTAGCGACCAAGGCTCACGAGCTTGACAGCC
TATACGCCGACAAGCTCAAGATCGAGATAGAGTATGAAAGCGTGGTGCGCAGCTCCGAGGCTCGAAGTGACTCTTTCAAG
GCTGCTGCCGAAGGCAGCCGTAAGGAAGTCGAAGACCTCAGGCGAAAGCTCCAGGACGAAGGTGTGTACAAATTCCAAAA
CACAGGATAGGTGTAATTTCGGGCCATTGCGGAATCTAATGTTTTCCTCTTCCAGAGAACGCGCGACGTGCCATCGAAAA
CGAGCTTCAGGCTCTCAAGTCATCCGGGGCCAATTCTCAGGCAGATATCGAGCGCCTCGCCAGCCGCAACGCGTCCCTGG
AGGCTTCTAACCGCGACACCCTGTCTATTCTCGAGTCCAAGACGTCAGCCAACGCCGAGCTCGCCGAGGAGTTGCAGGCC
CAACACCAGAAGAACCTCAAGCTGGGCCAAGAAATTACCGCACTCCAGCAATCTGTCCAGAATGCGCAGTCCGGTGTCAG
CAGCGCCAAGTTTCGCGAGCAGTCGCTGCAGCAGGAGCTCGAGTTCGCCCGAAAGAACAACCAGTGGTTCGAGACCGAGC
TGAAGACCAAGGCCGAAGAGTCGCTCAAGTTCCGCAAGGAGAAGGCCGCCCGCATTGCCGAGCTCCAGCGCCAGAATGAA
GAGACACAGTCGAACATCGAATCGCTGAGCCGCACTGAGAAGCAGCTGCGCACGCGCCTGGAAGATGCCCAACGGAAAGC
CGACGAGGCTCTGTCCAAGGTGCAACAGCTTCAGGAAGCCGCCGCACGCAACGAGGAAGGCTTCCGCGCCGAGCTGGAGT
CGTCCAACCGCCTCGTCGAGCTGAAGGAGCAGCAGACCGAGACGCATCGCAATCGGTTACGCGAAGTGGAGCTACGCCTC
GAGCAGGTCAAGGACGAGTCGGCCGACGAAGTGCGGAGGGTCCGCCAGGAGATGGAGCAGATCAAGGAAGACCTACAGCA
GGCGGAACAGCGCGCCCAGCAGCTCGAGGCCGAAGTCGATCGGCTCCAGGCTGTCTTGGCGTCTCCCGTTGCTGCTTCCA
GAGTGCCGCCCGGTTCGGCGCCCCAGACACCCCGCGCCAACGGAACCGGGAACGGTAATGCCGGATGGGCTGCGTCGCCA
TTTGGTACGCCCGGCTCCATTCTTCGCGGCAAATCCAGCATCACGGCGGCACAGGCGATGGAAGAGCTCTACAAGACTAA
GGGCGAGCTCACGCGCGAGAGGAGACGTACGCAGGAACTGTCCCGGGAGCTGGACGAGATCATGAGCGCCCTGGAGGCGA
AGAGCCCCGAGATCGCTGATCTGCAGGAAGAGGCTGAGCGCCTACGGACCGAGAATGTGCAAATTTCGCGGCTGTGCGAG
GAGAGCTTCGGTGAGCGTGACGTGGCCAAGAAGGCCGCGAAGAAGGCAGAAGCTAGCAGCATCACGGCACAGGCGGAGAT
CGAGATCCTGCGCACCCAACTCCGCGACCTCAGCACGCAGATCCAGCTGCTCGTCTTTAACCTGCAGGCCCGCGAAAAGG
GCCTCGGCGAGCTTTCGGAAGAAGAAGTGCAGCAGTTCGAGCGCCTCCAGAAAGGCCGGGTCACCGAGGGTGCCCTAGAC
GACCTGTCGGACACGCACCAGTTCATATCAGAGCGGTTTGTGGTGTTCAAGGACATCCGGGAGCTGCAGGAGAAGAACGC
GGAGCTGCTGCGCGTCACACGCGAGCTAGCCAACAAGATGGAGAACGACGAAGCCTCGGAGGCCAAGCGCCAGGCAGAGC
GTGACCAGGTGGAGCTGAAGACGCTCCGCGACACTGTATCTCGGCTTCAAGATGAGTCTAAGTCGGTGACGATCCGGATG
AAGAGTTATATGACAGAGCGCGATATGTTCCGTCGCATGCTGCAGCAGAAGGCCAGCCTTGCCGAAATCAGCTCTGTTCT
CGGCGGGTCGGTCGACGGCAGCCAGCGCGAGGTGCTCGCTAGTGTCGAGCGCCACTCGACAGCGGATGAAGGAGAGCTGA
CTGTGGCGCTCCGCGAGCTGCAGAATAACTTTGATTCGTACCGCAGCGAGCAGGGCGTGGACCGGAAGACGATGCGCAGC
CAGGTGGAGAAGCTGTCGATGGAGAGAAGCAGCTTGCACGCGGAGATTGCGCGGGTCAGCAGCCAGCTAACGCTTGCATC
TGAGCGCTACGAGATGCTCCAGTCCAACTACGCGGCGCTGGAGACAGACAACCGGGCGCTGCAGGAGAAGAACCAGAGCC
TGTCGGAGTCGTACGCCAAGCAGGACATCCGGACGCAGCAGGTGGCGATGGACCTGGTGGAGGTGCGCAGCCTGCTGGAG
AGCATGCGCAACGAGAACGCGAACCTCAAGGCGGAGAAGACGCTCTGGAAGGGCATCCAAGACCGGCTGAGCCAAGACAA
CGAGAGCCTGGGCGAGGATAAGGCGCGATTAAACAGTCTGCTGGCATCGCAGCAGAGCTTGCTCAACGAACGCGAGCTGT
CGGAGTCGGAGATGCGGCGGCGGCTGCAGGCGCAGATCGACAAGGCGGAGGCGGAGCTCACGACGACGAAGAGGAAGCTC
TCGGAAGAGACGGAAGAGGCGAAGAAGCTGCAGCTGCGCAAGGAGTACGAGGGCCAGGAGGCGCAGAAGCGGATCGACGA
TCTGATGGCGACGATCAGCCAGAGCAAGGAGGAGTTGGTGGCAACCAAGACGAGCCGAGATCACCTCCAGGCACGGGTCA
ACGAGCTGACGATCGAGCTGCGGAGCGCAGAAGAGCGGACGCAGAGGCTGCAGCCACGGCCGACGTCGAGGGTGCAGAAA
CAGGCACAGGACGATGCGAACGCGGACGCGGACGAGCAGGCGGCGACACAACTGCAGGAGCTGGAGGCCGAGGTGGCCGA
GCTCCGACGGGAGCTGGAGCTGACGCAGTCGGAGCTGGAAAGCACCAAGGCGGAGACGGCATCGTACAAGGACATTGCGC
AGTCGGCGGAGGAAGACCTGAACAGCATCAACGAGTCGCAGGAGCAGTACCGACAGGAGATGGATGCGGCGCTGGCGGCC
AAGGACACGCGGATCCAGGAGCTGGAGCAAGCGGTCGAGGGGCTGTCGGCAGAGCTTACCAAGTCTAACGGCGAGCTCAA
CACGCTACGGGACTCGCAAGCGGAGCTGGGACGGAAGCTGGAGGACGAAAAGCGAATCCTAGAGTCGGAGATCGGGCGAC
TCAAGGAGGTGGAGGAGCGAGCAAAGGACGAGAAGAAGTACCACCAGTCAGACCTGCGGGCGCAGGCGGAGATTGCAAGC
AAGGCGCAGCGGGACTACGAGCAGGAGCTGGTGAAGCACGCGGACGCGGCAAAGCAGCTGCAGGTGCTGCGGGCGGAACA
CAACCATCTGCGGACGGAGGCGGCGTCGTGGAGGGCGGAAGCGGAGTCGGCCAAGGTGGCGCTGAGCCAGAGCGAGTCGT
CATGGGAGGAGCGACGACAACAGTTTGAACAGGAGGTGTCGGAGATGCGGGCACGACGCGAAGACACCAACGCGCAGAAC
AAGCTACTAGGACAGCAGCTGGAGAGCGTGACGGCACAGATTGCGAGCCTACAGCACAGCCGGGTGTCGATGGGAGAGGC
AGACGGCGAGGGAGCAGGCGGATCAACGCCGGCAGCGCTCGCAGACACGGCAACAGAAGGACTGCGCGAGCTCAACAGCT
ACCTGCGGCGCGAGAAGGAGATCCTGGAGGTGCAGTACAACCTCAAGCTGCAGGAGACGCAGCGGCTGCAGCAAAAGGTG
GAGTACGGACAGGCGCAGCTGGACGAGGCGCGGCTAAAGCTGGAGCAGGAGAGGCGGTCGCAGGCCGACGTCAGCCGATC
GTCACAGACGCACAAGGAGCTGATGGAGAAGCTGAACGAGCTGAACTTGATCCGGGAGAGCAACGTGACGCTGCGGAACG
ACAACCAGAAGGCACAGGCACAGCTAGGGCAGAAGGAGGTGCGGCTGCAGGAGCTGCAGGCACAGCTAGAGCCGCTGAGC
CAGCGGGTATCGGAGCTAGAGAACCAGAAGCAGTTCTTGGAGGAAGAGATGCGGCAGATCGGCGAGGACCGAGACCGGTG
GCAGAAGCGGACGGAGAGCATCCTCAGCAAGTACGGACAGGTGGCGGATGCGACGGAGATGGAGCAGCTGCGACAGGCGA
TGGCACAGGTGGAGGCAGAGCGGGCGACACTGCAGGAAGCCGAGGCAGCACAGCGACAGAAGGTGCAGGAGCTAGAGGCG
ACGGTAGAGACGGAACGAGGCCAGTGGCGGGAGAGCCGACAGAAGCTGATCGAGCAGGCCAAGGAGAAGGCACGACAGCA
GGGAGCACAGATCCGCGAGCTGATAGGACAGAAGAACGAGCTACAGGAGCAGCTGACGGCAACGAGCTCACGGCTGGCAG
CGATGGAGGTGCTGGAGGGAGAGCTGACGGGAGCTCGAGCAGAGAGAGAGGCGCTCGAAAGTCGGATCCGGGAGCTGGAG
GTGGCCGTGGTGGAGGCGAGTGCGACAACGACAACGACGACGATGCCGACAGACGAGATGCCAAAGGTGTCGGCAGCCGA
AGCAACAGACGGCGTCGAATCCTCCTCACCAGAAGACGTCGAGATGGGCGGATCAGGAGGGCAGGTCAGCCAGCGGCAAG
ACGAGGTGGACCGGCTGCAGACGGAGCTGCAGACGATGCAGGCCGAAAAGGCAGCGGTGGAGCAGGAGCTGGCAGACGTG
CGCAGCCAGCTGGAGGCAGTGGTGCGCGAGCGGGATCAGGCATTGGAGGTCGGCGGCGAGGGAGCAGCACCAACAGCAAC
AGCAACAGCAGCGACCGTATCAGCAGACGAGAGGGCAGTTCTGGAGCAGCGGGTGGCGGCCGCCGAGGCCAACGCGGCGG
TGTTTGAGCAAAAGGCCAAAGAGGTGGAAGACAACATCCAGGCGATCCTCAAGGAGCGGTCGGACAAGATGAAGGACGCG
CTGAACCGGCGGCTGAAGGAGTCGAAGGAGAAGGGCGAGCAGGAGCTGCGGGAAGCTCGCGAGAAGCTGCAGGCTGAGCT
GGAGCAGCGGCTGGAGCAGGAGAAGAAGACATGGACGAGTGAGGGAGCAGGAGCAGGAGCGGGAGCAGGAGAAGCACCAG
GAGCACCACAGCCGCAAGTTCCAGTCAAATCAGAGCCTCAGACACCAATGATGGACCTGTCGAAGCTGGGCGACGCGGAG
ACACGCGACCTGCTGGCGAGCAACGCGACAATCCGCAGCATTGTGGCGTCCAACATCAAGAAGAAGATGGACCAGGAGAG
CCGGCGAGTGCGGGAAGAATTGGAGCTGGTGGTGCGAGCAGAGTTCGAGGGCAAGATTGCGTCGGCACGGGAGACGGGTC
AGATGATGGCCGAGAAGAAGTCATCGATCCGCATCAACATGGCGGAGAACAAGCTGAAGACGGCCAACGCGAAGCTGGAA
GTAGTGTCGACAGCGGCTGTGCAGACGCCTCAGCGACCGGTTGTCGAAGTTTGGGCTGTGGCCAAAGATGCTCGGCCAGC
GCCTGTTGTGGTAGCAGTTCCAGCACAAGTTGTCCCAGCGACTCCGGCGACTCCGGCGACTCCGGCGACTCCAGCAGCTG
CGACAGCACAAGCAGCCCCGATGACTCCAGTCCAGACAGCAGCTCCGTCAACTCCTGGACAGGAATCCAAGCCGGTCATT
GTGCAGGCAGCTCGGCCGGCCAACTCGAACCTGCCAGCCAAGCCAGTCGCTCCAGGACAACAGCAACGGCAGCAACAACA
GCAACAGCAGCCAAAGTCTCTGCCTGCAGCAGTCAATGCTACAAACATCAACCCGTTCAGCGGCAAGCCAGCGCCTCCGT
CGTCACTGCCCAATCCTTTCCAGAAGCAACAGCAGCCAGCGGCTTTAGGACAGCAGAACCAGCAGGCACAACCAAACCAG
CAGGCACAACCAAACCAGCCAGGCCAACCAAACCAAGCAGGCCAACCAAACCAAGCAGGCCAACAGGCCCAGAACCAACA
GACTGTGCGAAGCGCCATTCCGGTTCCAGGCGGCGGCCGTGGCGGTGCCAACACGGGCAACCGCGGCGGTGGAGCAGGCG
GTCGCGGCGGCGGCGTGTATCAAGCGCCGCGTGGCGGTCGGGGAGGCGGACGCGGAGGCGGTGGACAGGGTCGTGGCGGC
AGCAATGCTGGTGCGGCCGGACAGATGAATGCCGGCGCTGAGCCGTTCAATCCCAACAACAAGCGGCTGAGGAACGAGGG
AGAGGCTGCTGGTGGACCAGTTGGAGGAGGCAAGCGGATGCGCGGAGGAGGACCGAATCATTGAGGGAGAGAGGGAGAGA
GGGAGAGGGAAAGAGAAACGAGGACCGAGAAGGAGGAATGAGAGAGATGACAATGTCACGTGATCACATGGAGGCTCGGC
CATTGTACTAGTAATTTCATTTATTGTTTAACATAGGTTCATTTGATTGTAAAGCATTAGAGCACGTCTTTGTCATAGCA
CAAGAACCACAACGGCAACAGTTGCAGCGAGCAGGGCGACATGTCTGTGCAGCGGTGCCAGCTGAGCGTTGCGGCCAGCA
CTGCTGATGGTGGATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62