GenePrediction:GLEAN_8211 Details

Name: GLEAN_8211
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:321922..320548 (- strand)
Length: 1375
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:321922..321697 (- strand)
Length: 226
Type: CDS
Source: GLEAN
Position: GCSC_113:321603..321537 (- strand)
Length: 67
Type: CDS
Source: GLEAN
Position: GCSC_113:321254..320810 (- strand)
Length: 445
Type: CDS
Source: GLEAN
Position: GCSC_113:320655..320548 (- strand)
Length: 108
>GLEAN_8211 class=GenePrediction position=GCSC_113:321922..320548 (- strand)
ATGTTCAGCGTACCACAACACCAGATGTACGGCTACCCGGCGCCAGTACCAGCATCCATGGTGCAGACAGCCGCACCCGT
GGCCACAGCTCCCACTCGACAGTACGCGAACCACAGCAACAGCAGCGCCTTCAGCAGCTCAGCCAACCCGGACGAGGACT
GGACCAAGATCTCCGATCTGGCCGAGCGGCGCCGGATACAGAACCGGATTGCCCAGCGCAATTACCGTAGGCTCTTCCTG
CCATCCTGCCGTTTAACCCCTTTCAACTCCTGCCCTCCCTCTCTCCTCTTCTCCCTCTCCGCTGCTGACACAAGAACAGG
CAAGAAGCTTAAGCGGCGTTTGGAGGACCTGGAGCGGCGTGCCAGCTCATCCGACGGCAAATCACCGTCGCCTTCCGGCA
GCTCTGGCAGCAACGGCAGCACTGGCAGCAAGACCACCAGCGGGAGCCGGAGCAATAGCGCCAGCTCCTCAGGCAAAGTA
CACCGGCCCAAGAAGCAGCAGCCCACGCTCTCGTCCCTTTCTGCCGCAGAGGCCGCCCACCAACAGCGGCAGCAACGGCA
GCAACAGCAGCAGCAACAACAACAACAGAGACGCACATCCCCATTCCAACAGCAAGAACACCTGCACCCGGTCATGATCC
CACGTCCAAAACAGGCCGTCGCGCAAAGCCACTTCACGCCTCCACTGAACCACGACGACGACCTGCTGTTTGCGCCCACA
ACCTACGACGACCGCTCGCGCTCGCACACGCCCCCCAACATGTTCTCAAACTATTCCACCTACCCGGCGCCGCCAGAAGA
CATGTTGGTCGGCAACGCGCACAGCACAGCCGCTTCTGCCCAGTCCTACCGCACGGACACGACTGCGGCATATAGCTACG
ACTGGATCTTGGCGAACGAGGTTCCCGTCCCGCTGCCGTCAATGGGCCACCACAGTCAACACGGCCACCACCAGTTTGGT
GGTAGCCACATCAAGCGGGAGGTAGGCGTCGACGATGACGCCGCAGCTGTTGCTGCAGCTGTAGCTGCTACCACAATCCC
CCCCTACATGAGCTATCACTTCATGCCAACGGCCGGCATGGATACGGCCAACCCCTTCGACTCGAACCCTCATGTGAGTT
TGCAGCGATCCTGAAGACCTGCTCTTCTGTAGATCTTCTTTGTCTCTTGTCTTCTTTCTTTGCCTCTCCGGGGAGAAGGA
AGATGAAAGAGAACTAGCAAAAAAAGAAAAAAGAAAAACATCCTGACCTGGCTCGCTCTCGGCACAGACCCCTCCGCTGG
CACACTCGTACGACCACTCGACCAGCTGCTCCGACGCCGACTACGAATATCCCACGACACCATTGTCCATGGCATCACCC
GGAGTCGTGGCCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62