GenePrediction:GLEAN_8212 Details

Name: GLEAN_8212
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:312170..307821 (- strand)
Length: 4350
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:312170..307821 (- strand)
Length: 4350
>GLEAN_8212 class=GenePrediction position=GCSC_113:312170..307821 (- strand)
ATGATTGTGGACAAGGAAAACGCCGTTATGAATCTGCAAAACGAACGAATAACACTGCTCCCGGCAAATCATCGCAACGT
GGCCATGTTTAGCTCGCAGAACGACCCCTCCTATATCGCCATTCGCAATGCACTAGCCACGATTATAACCGAGCAGCGCA
ACAGATCCCAGGCTTACGGGCATGCCGTGGCACAGGAGGACAGACTTGCCTTAAACAGGTTTCTTAATGTGTCTGGCCCA
CCGGAAGACGACTTTGAGACGAACAACTCCCGCCGTGTGCCTGGGTCGTGCCAGTGGATCAGCCGCGCAAGATCGTACTC
CTCGTGGAGAAACGTACAGCATCCACGCCTTCTCTGGCTCCACGGCCGTCCTGGCACCGGGAAGAGCGTTCTTTCCAGTT
ACATTATCGAAGACCTGCAGTTGGAAGGCAACGTCGATTGCTGCTACTTCTTCTTCCAGTCCACCGACAGTTCAAAAGCC
ACCACAAATGCATGCCTGCGATCCATGGCATGGCAGATGGCCATGCTACACAGGAACATCATGATCAGGCTGAAACAGAT
AATGATGGATCTGGATTACGACCCAGTAGACAGAGTCGACCACGGCCCAGTATGGCGGAATATATACTCATCTGGAATTC
TGAAAGAACGGCCTAACCGGCCACAGTTCTGGGTGATCGATGCGGTCGATGAGTGTAAAAACAGCACGGAACTGATCAAC
TTCATAGCTCGGATTCAAGAGCAGTGGAATGTGTCAGTAATGATAACATGCCGCAATCCCTTCGAGCGGTATCCCATCAA
CGTGAATACGCGCCTTGATGTGGAATCATACACCATCTCTGAGGAGGACAGCAAGCAAGATATTGGCCTGTTTCTGAAGC
ACGACTCAGAGAAGCTGCGGCGCCTGCCTCTCATGCAGGGCGAAGAGCCAGAAGATATCGCTTTGGAAATTGTAAACCGT
TCTGACGGGTCGTTTTTGTGGGCGTCGATTGTGTTTACGAAGATCCAGCAAGTGACGAGCAGGGGAGAGATCGAGCTGGT
ACTGAAGAGCATACCACCGGACATGGATGCTCTGTATTCTCAGATTCTGCGAGATATCAACAACGCACAGTATGGAAAGG
GCTTGGCCAAGGACCTTTTGACGTGGGCGACGTACGCCTTTCGGCCGCTGAAAACAGCAGAACTCCAAGAGCCCATCGAG
ATTGGCATTAATGACACAATAGGGGATATTGATAGTGCGATCAAGCGGTGCTGTGGAAACATGCTTCACGTCAACGCGCA
GCGTGAAATTCGCTTTGTCCACTCGACGGCACGGGAGTTTCTTCAGCAAAGTGAGCTCGTTGAACCAGACTTTTACGTGC
ACAAGGCCAATGGCCACCAGAAGCTAGCCTTGACTTGTCTTCGTTATCTGATGGATAGAGGTAGGGTACAGCACAATATG
AAGAGCTCTCGCGATTCCAGAACCGCGTCGATGCAAGCGTGGGGGACAACAGTGCCGTTAGCTAGGAGGAGGAGGACGCG
CAATAGCATCGTTACTGCAGGCTCCGAAGGTTCTGGCTCTTCGGCATCTTCACCTATCTTTGTTGCACAATATCGCACCT
CTCCAACAACGGACGTCGCTGGTGCATTCACAGACTATGCGTCCACGTTTGTGTTCAAACACCTCGAGTTGGTTCATACC
AACGATGACAGCATTTTTACCGTGCTGTCGACGTTTCTGGGACAGCAAAGCTGCCTCCGTTGGATTGAGTATGTGGCCAC
GACAAGAAATCTACACATCATCTACGAAGCAGGACACATCATCAACTCGCTGCTTCGTCGACGCGGCAAACACTCACCAC
CTCTAGGGTTAGCACGTGGAAAAAGTCAAGAACAGGTTGTCATGCTGGAGAAATGGGGCGATGATCTTATTCACCTGGTG
ACAAAATTCTCGCATTGGATGGAGACATTGCCGGTGTCGATCCACAGCTTGATTCCGCCGTTCTGTCCGGCCAAGTCAGC
TATCCGTCAGCAGTTCACACATCCACTGCGAGGAATGAGTGTGCAAGGCCTCTCGAACGAAGGATGGGACGACTGCTTGA
CGACGATCACCTACGCGGCCGACGTGAAGCCCAGTGCCGTGGCAGCAGGCCAAGGGTTCATCGCTGTTGGCACGACGGAG
GTGAAAGTGGGCAGAGTCGTCGTTTACGACGATTCCATCTTCCAGCAGGTGCACACGCTCCAACATGGAGAGCCGGTTCT
ACATGTTGCCTTTCTGGAAACAGGGCAGCTGCTGGCATCTGCCGGAGCAACAACTGTGCGAATTTGGTCTACGGCTGACG
GGGAGGAAAAGGCAAGCTTTGGTATCAGGTCCGTTTGCATAGCACTTGACTTTTCAGAGTTCGAGGACGAAGGCTGTATA
CTTCGCGTGGCAACACGGCGAAACGAACTGTACGAATATTTCGTCGGCAGCTGCGAACTCAACCAGCAAACGTGGACCAG
CCGCCCTGAAGCGGTCCAGTCGCTGGCCCCCTACATTGCTACTTTCCTGCCGTCGGAGAGCCAACTGTGCATGGTATACC
GGGGCAAGAATGCACGCATCTGGAACTTTGAAGAAGACACGATAGCCACGTATGAGAAGTCGAGGGGATGCGTCGAACTC
TTCGGACAGTCTGGCATCCCCGAAGGATCCGAATCGATCCGAGCCATGTGTGTGGGTAAAGACGTCAACACGAACCGACT
AGCAATCGTCTACAACGACGGTGACCTTGTCGTGTTCAATCTGGACGACGGCCGGCCTGCAAATATTATCAAAGGTGTCA
ACACCATGCTGGTGGCAGCATCATTTGACGGAAGAACATTGGCCGCGGTGGACTCGTCCGGCAACCTTTCGCTGTTTGAG
TTTAACACCCTGCGACTGCTCTATCGTGTCCAGTTCGACACTAGGATTCTGCCCAAAGGCTTGACGTTCACCACAGACGA
CAGACACTTTGTGGAAATTCGCGGCAACCAGTGTCGTGTATGGGGTCCGACAGTGCTGCTGCGAACGGACATGCCCGGCG
AGGAGAACAGCGACACGGTATCGGTGTCCAGTGGGCCGCAGGAATACGACTACTCGCCGGCAGCAGGCGAGAATATCACC
GCGCTGGCCGTCAGTCGTCTTTTCAGAACGGCTTTCACAGCCACAGCAGGTGGATCGGTCTACGCCTACGACACAACCGA
CAGCTCCCGTACACCTGTCCACTTGTTCACACAGGCGATCGGGTTGGCGATTGACCTGTTGTATGTAGACGAGATGCCCT
CAGTGTTATCGAGAGCGACATCGCTCAGTCTGCTGATCGCAACTGGGGACCTGTCCGGATGTGTGACCGTGCGCCATATT
ACGCGAAACAACGTGGCCCGCCAGCGAGTCTGGGATGTGCAGGAGCCCATCGTCGTGACGCGCTCGCCAGCCCTCGGCAT
AGTGAGACAGATCGTGGCCTCGGCAAATCAGCAGCGGCTGCTGGTCTCTACGGACCAGTATGACGTGCTGTGGCCTACGC
CGAAACAGGGCGAGGCGTCCTGGAAGGCCAAGATAGATGGCTGGGCGCGTCCTCACTGGGTGCCACATCCACAGGACCCG
GCACTGCTCATCCGTGTTCCCGAAGTCGTGGCATCGTCGATAGTCTTGGATTCAAGCTTTGATCTTGTGCGCTGGGATGA
TCTCAGCACTGTTCGGTCTGTGCCTGTTCCGGTTCTTACAGGCTTTGACCGTATTTTATCTCTTCAGCACTCCCGCTTCT
TTGTTACAGTGCAAAAGAATTCATCCCCCCAGCATGGGAAGACCCCCGACGCTAGCAAGAACAGTACGTGCATCCAGATT
TGGGATGCGGATATGTTTAGCGATGAGACAAGTTCTTCTGTGAGACAATCCGTGAGAAAACTTCAGCGTGGGGTCAAGGA
CGGAAATAGCCAGGAGAGGCAATCGACCAGCGCAGAAGCCATTGTCGGTTGTGTTACAGACAATCGTCTGATTGTTTCCA
CATCAGACCATTGGATCGCATCGATTGATCTGTCCCAACCAGATCGTATCGCACACCTAGCATCGGAGATAGACGAACTG
TCTGTTTCATCACAGCCCGCATCTATATCACTCCAGCGGCACTTCTTCTTGCCGAGTGACTGGGTCAGTGTTGGGCCGGC
CTTTCTCATGTGCGTTGGCCCAGAAGACGAGTTTCTGTTTGTAAAGCACACGGAGCTGGCAGTCGTCAAGCGTGGACTGT
CACACCGGACAGATGCGGGCTTCGGCAGCGCTCGTTTACGCCAAACCAGCAGGCCACCCTTCTCGCAAACTAGTTCTACA
GGCCCCATGGGCGAAAGAAGGCGGGGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62