GenePrediction:GLEAN_8213 Details

Name: GLEAN_8213
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:297142..296585 (- strand)
Length: 558
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:297142..297099 (- strand)
Length: 44
Type: CDS
Source: GLEAN
Position: GCSC_113:297016..296936 (- strand)
Length: 81
Type: CDS
Source: GLEAN
Position: GCSC_113:296876..296585 (- strand)
Length: 292
>GLEAN_8213 class=GenePrediction position=GCSC_113:297142..296585 (- strand)
ATGACGACCGCTGCGATCGAGGCAGCAAGGAACGGCGCCGATTGGTAAGACAGAGTGCCGTCGCGAGAAGAGATTCGGTT
TACCCGATTCTTACTGGCCGCACGCATTCTTGTGGACACACCTCAGCAAGTGCATGGAGCGGTACCGCGCATACTTCTCT
GACGAGGACGAGGAGGCCGACCAGGTGACAGAAAATAGCATCAGCCTGTGCGCTGAAGATTGGCCCATAGAAAATTGTGA
CATTACGCCTGCCCCGTCTTCAGTAGCTCCTACGACTACACCGAGCGCTACGAACTTTTTGCAAGGGAGCGGCTATTTGA
CAAAGAATCTCGAGACAATTTTAGATTGTCTTCGCTGGCGGATTTTGTGAACACTCTCAGTGCGAAACTCGACACACAAC
AGAGACGAGCCCAAATATTGTTCTCCACAAATGCCTGTCTTGTTGCAAGGGCAGATGAGAGCGACTCTAAGTTTGAAAGC
ATACATTCCCGACTCGACCGCCTGGAAACTATGCTGGCCTCTGTGGGCAGTACTGCGAGTTCTGGCGAGAACGAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62