GenePrediction:GLEAN_8215 Details

Name: GLEAN_8215
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:294647..290690 (- strand)
Length: 3958
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:294647..293034 (- strand)
Length: 1614
Type: CDS
Source: GLEAN
Position: GCSC_113:292880..292713 (- strand)
Length: 168
Type: CDS
Source: GLEAN
Position: GCSC_113:292642..292347 (- strand)
Length: 296
Type: CDS
Source: GLEAN
Position: GCSC_113:292201..292047 (- strand)
Length: 155
Type: CDS
Source: GLEAN
Position: GCSC_113:291978..290690 (- strand)
Length: 1289
>GLEAN_8215 class=GenePrediction position=GCSC_113:294647..290690 (- strand)
ATGGCTAAGGAGAAGAAGGGAGGAAAGAGCGAGGGCAAGAAGGCCAAGGCGGCAGAGAAGAAGCAGAAGGCGGAGAAGAA
GGCGGCGAAGAAGGCTAAGGTCAAGAATGCCAAGCAAGAAGGCAGCGATGCCGAGGACGTGGACCTGGATGCGGTTCTGG
AAGAGTACAAGCGGCAGCAGGAGCAGTTCCTAAAGATCACCGAGGTGGTGGCCGTGGAGCCGCCAAGGGCGCGGGCAGCG
GCGAGTTTCCTGGCGTCGCCGGGCAACAGCAACCAGCTGCTGCTGTTTGGAGGGGAATACTTCAATGGGGCGCTGGCGAC
CTTCTTCAACGACCTGCACGTGTACTACATTGACCGGGACGAGTGGCGGACGGTGACGTCGCCAAACACACCGCTGCCGC
GGTCGGGCCATGCGTGGTGTCGGGGTGGCAACCAGAGCGGCAGCGTGTTTCTGTTTGGGGGGGAGTTTAGCTCGCCGAAG
CAGGGGACGTTTTACCACTACAATGATTTCTGGCGACTGGACGCAGCCTCGCGTGAATGGACACGGTTGGACAGCGGTAG
CGGAGGTGGTGGAAAGGGAAAGTCGCCGCCAGCACGCAGCGGTCATCGGATGACATACTACAAGAACTACATCATCCTGT
TTGGCGGCTTTCAGGACACGGCCAACCAGACACGCTACCTGGCAGATCTCTGGATCTACGACACGGCTAATTTCATGTGG
CACTGCCCTACACTGCCGCCAGCCCAGCTGAAGCCTGACGCCCGCTCATCCTTCACGCTGCTACCGCACGAACAGGGTGC
TGTGCTGTACGGCGGCTACTCGCGCGTCAAGACAGCCGTGGGCAACAGACAGGGCGGTGGCGGCCAGCGCATGGCCATGA
AGGCCGTCGTGCACCAGGACTGCTTCTTCCTGCGCATCACGCCACCGGCAGCCGGGGCCGCACCAGGAGCACCGCCCCAA
GTGCGCTGGGAACGACGAAAGAAGCCGGCCAACACGCCTGTCCCCGTGCGGGCTGGCACCACCATGGCCTTTCATCGCGG
CCGGGGCATCCTCTTTGGCGGCGTGCACGACGTTGAGGAGAGCGAGGAGGGTCTCGACAGTGAGTTCTTTAACGGCCTTT
TTGCCTGGAACATTGAGCGGAACCGGTTCTTCCCCATGGCGCTACGCAAGCCGCGGACTGCACCCAAAAAAACGGCCGGA
TTCGGTGGAGGAGCAGACGGTCAGCGGGTCGGCAGGCGGAATCGTGCTGCAGCCAACGAAGAGGAGCTGTTGCGCCAGCT
GGCCGCGCTCGAAGCGACGGACAAGAAGAAAGGCAGTGGCGGTAATGAGGAAGACGATGCCATGGATGTGGATGGTGCTG
ATGTTGCTGCTGCTGCTGCGAAAGCCGAAGAGGAGGCAGCGGTTGTGGTGCGGCAGAAGCCTGTGTCGATGGAGCTACCA
CACGTACGCTTCAACTCGCTGCTGGCCGTGCAGGGTGACGTGCTGTACATCTATGGCGGCACGTACGAGAAGGACGACCG
CGAGTTTACGTTTGACGATATGTACGTCGTCGATCTCGGCAAGCTGGACGGCTGCAAAGAGATTTTCAGTCGGGCTCTGG
ACGACACCTGGATTGTACGTTGCTGTTTCTGGCCTCTTTGTGTGCCTGTTTGGTTGCTGACTGTGTTGCAGGAATCGGAG
GACGAGGACGAGGACGACGATGAGGAAGACGACGAGGAAGACGAGGACGAAGAGGACGATGCTGCTGATGCGATGGAGGA
CGTGCAGGCGACCGGGCCCAAGAAGATCTCACCGAGCTTGCGCAAGAAGGGCAAGACAGCCTCTGAGGCTGGCTCGGACT
CGACGGCGCCGTCAGTGGCCAGCACAGACGACATGGACACCGAAACCGAGGCTGACACTGCGGCCACGTCCGACGACGGT
CTGCCATACCCAAGGGTGAGATTTCGTTTTCGTTCTTTTTTCTCTTCTTTCTTCTTCTCTTTTTCTTTCCTTCCTAACTT
CTCAGCCATTTGAATCCCGTCGCGACTTCTTCAACCGCACGTCCAACGAGTGGCAGGAGATCCTCATGACGAGCCTGCGC
TGGAAGGGCATCCAGCCGGAGTCACTAGCCATCAAGGAAATCAAGACCAAGGCGTTTGAGATGAGCGAGGAGAAGTGGTG
GGACTGCCGCGAAGAGATCAACGCGCTCGAGGACGAACAGGAAGCTGCCGGCATCGGCGAGGTCGTGTCGCTGGCCGACC
GTGCAGGAGGCGGAAGCGGAGGCGGTGGAGGCAGCAGTGGTGGTGGAGCCCAACGCAGGAGGTGAGAATGGAGAAGAGGG
GATATGGAGTACATGCTGTACGAGTACAGAGTACAGAGCAATGGATGCACACATGGTTAAGGATATCACGTGACTTGGCG
TTGCGGGGATCTTGCTTGCCACCGCGATCGTCGTTTTCGTTGACAGACATACGGTCCGTCACATCACCATGCCTGTTGGA
ATCCAGAGGTTGAATGCGCGGAAGTCGCAGCCGAATCCACACATTGTGTTCATCAAGCCGCTCAAGGGACCGGATGAGGA
GGCAGCCCGCGACTTTCTCGAGCGAATAGCAGCGCAATGTGGTAGGCCAAAGAGGCAGAGAGAGAGCGAGATGGAGAAGA
GTGGTCTTGGCTGACCCGGACTGGCGCAGTGCCGATCATGCGGGAGAACCACCTCAGCGTGGTCACGCTGGAGGAGTACG
AGCCGAACGCGTCGTTTGTCGGGCGCAACTTCAACGGCGGCGAGGTGATCCAGCTGGTGCTCAAGGCGCGTTTTTCTGGC
CGCTGGCTGCCCTTTCCGTACGTCCAGATGGTCATGATGCACGAGCTGGCCCACTGCCGCCACATGAATCACGCGCGCGC
CTTCTGGGCCGTGCGCGACACCTATGCCGCCCACATGCGCGGCCTGTGGGAGCAGCACTACACGGGCGAGGGTCTCTGGG
GGCGCGGCGCGCGGCTGGACGATGCGTTTGGCGAGCGAAACACGGCGCGACCGGACGGCGACGATGACGGCGTGCTGCTG
GAGCACCTCTGCGGCGGGACGTTTCGGTCGCGTGGCCGAGCCAAGAAGCGGAAGCCGGCCCTGACGTACCGCGAGCAGCA
GGAGCGGCGGATCCGGCGCAAGTTTGGCGAGAATGGGATGTCGCTGGGAGGAGACATTGCAGCACGGGCACGACTGGAGG
AAAAGACGGCCAAAAGCGTGGCCGTGAAGCCGCGGGTGGCCAAGAGCAAGCGCGGCCGGGACTTGCGGGCAGCAGCAGCA
CTGGCCCGGTTTGAGCAGAATGCCACGGAGAAGGAGGTGAAGGAGGGAGAAGGTGACGATATCGCTTCCATCAAGCGGGA
CGCAGACGAAGAGTCGTCCGACGACGACACAAAAGACCGGGACGCACCCGATGCTGTAGATATTGACGGCACGCGCATGG
TGGACGGCCAGGGACGAGGAATGGTGCGGGTATGCGAGATCAACGGTCTGGACGACGACGACGACGAGGCCGATACCAAG
AGGGAGTTGCGCGAACTGCTGCAGGGATCGACGTGGGAGAGAAGTCCGAAAGTAGAGGAAGAGCCAGAAGGCGACAAGCA
ACAACAACAACAGCAGCAGAAGCAGCAGTGTCGAGATGGCCAGAGACAGACGCCAACCGTCAAGTCGGAGCCGAAACAGG
AGACCAGAGAACGGACGCTGATGGGGATTCCTCTGGCTCCTGCCCATGCCCCTGCCACAATCACCTCTGTCTGTCCCGTC
TGCTCTCTGGCCAACGGGCCGCTGTCCGTCACCTGCGCCATGTGCGCCCATGTCCTGCTCTTCGAGGCTGACCCGGCCGC
ATGGCAGTGCCACAGTGCTGTTTGCAGCAGCAGTGCGGACAACCGCTACAGAAACGCGGGCGACTGTGGCCTATGCGGCG
TATGCGGCCAGCGGAGGGAGAGCAAGCCGGGTGGATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62