GenePrediction:GLEAN_8216 Details

Name: GLEAN_8216
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:283689..277554 (- strand)
Length: 6136
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:283689..283440 (- strand)
Length: 250
Type: CDS
Source: GLEAN
Position: GCSC_113:283353..283226 (- strand)
Length: 128
Type: CDS
Source: GLEAN
Position: GCSC_113:283154..280499 (- strand)
Length: 2656
Type: CDS
Source: GLEAN
Position: GCSC_113:280436..278929 (- strand)
Length: 1508
Type: CDS
Source: GLEAN
Position: GCSC_113:278840..277554 (- strand)
Length: 1287
>GLEAN_8216 class=GenePrediction position=GCSC_113:283689..277554 (- strand)
ATGCGGCCCTATAATTCTGCCAGCTTGGCTTCAAGCTGTCGTGGCTTGCCAGAAGAGCACGATGATCACGACAAGCCAGA
TGTTACAGTACCGACGTGCGCTCACTCTGCGTCCCATCCACTACAGCACCCTGTCTCAGACTTTGGTTCCATGGCCCGCG
AGCTTCCGCCGGGGCGTCGGTCCATTTCGCCGGACAGCTCCGGCCGGGACTCGCCCATTCCACGACAGTGGAGAAACCAG
CTCGGAGGAGGTGAGTTGCGACAAACTGCCAGACGTTGGCAGAGTCTGGCCACTCTTTATATCCCCTTTCCTCTTTCACT
GTGCCAACAACTGCAGACGAACCCTTGATCAAGGACAAGGCTTACCGCAAGTATGCATCTGGCATCGATCGCGCCTTGTC
TCTCTTCGAGACGGCCCTGCAAGAATGGGCTGACTACATCTCGTTTCTGAACCGGCTTCTCAAGGTGTGTACACACGCTG
CTCCTTGTCTCCCGGTCGCACCTTGCCCCACTCTAACCGGCCATCTCTCCCCCAGGCCCTTCAAGCTCGACAGCCGCAGA
TGACAACGATTCCGGCCAAGGCGCGCGTGGCCAAGCGGCTGTCGCAGTGCCTGAACCCGACGCTGCCGTCGGGCGTGCAC
CAAAAGGCGCTCGAGGTATACAGTCACGTCTTTGCGATCATTGGCAGGGACGGCCTCTCCAAGGACCTGCCCGTCTATCT
GCCCGGGCTAGCACCCACGCTGTCGTTTGCGTCGCTCTCAGCGCGGGCGCACTTCTTCGACCTCCTGGAGCGCTACTTTC
TCGACCTGGACCCGCGATCGATGCGTCCGGCGCTCAAGTCGCTCATCCTGGCGCTCCTGCCTGGGCTCGAGGACGAGACG
GCCGAGGACTTTGACCGCACGCTGAAGCTGCTGAACCGCTTCAAGGTGGCGGTGCGGCCGCCCGACAGCCAGGACCTCAC
GGCCGACCACGCGACCGGCGACGCCTTCTTCTGGCAGTGTTTCTTCCTCGCGGCCATCACGAGCCAGAGCCGGCGGCCGG
GCGCGCTGGCCTACCTCGGGCGCTATCTGCCGAAGCTGGGACAACCGCTTACGTCAGCAGAGGGGTCAGCGGCACCGAGC
AAGGACAAGGATGGGCAGGCCGACCCAGCGTTACTGGCCAAACTGTCGCAGCTGGTGGTCTCGCCGGAGCCGGGGCTTCT
GCTGCGATGCTTTGCGGCCGGGCTGGCGGACGAGCAGCTGCTCATACAGCGCGGCTTTCTCGACCTGCTCGTGGCCCATC
TGCCGCTGCACACGAGCGTGCTGCAGACCCGGGTCAAGGCAGCCGATCTGGAGCTGCTGATCCGTGCAGCCTGCGGTGTG
GTGACGCGTCGCGAGATGAGCCTCAATCGGCGGCTATCGGCCTGGCTGATCGGTCCCGACCCACCGGCCGGCGAGAACGA
CAGCGCGCATCCGGAGTCGCCCATGGCGGCCACGCACGCCGACCGGCACCACGGCGGACAGAAGCCGAGCTACTTTGAAG
AGTACGGGCTGCAGCCGCTGACGCGGGCTCTCCTCAGCATGGTGCAGTCGAACGCGAGCACGACGCCGGCTGAGAGGGCA
CGGCCGTACCGGATCTGCCTCTCGCTGATGGACCGGTGGGAGATTGGCGGGCTGGTCGTGCCCGAAGTGTTCCTTCCGGT
AGTCGACAGCGTGCGACGGTACAAGGACGGGGCGCCGACCAAGACAGACTTCAACGAGGTGCTGCGCAGCGCCAGCGTCT
TCTTTGACGGAGTGGAGAGCGGGCTGATCTACGGGGAGATGCTGAGCCTGGTAGCCCAGGCCATCGGGCCAGGGCCTCTC
TCGGCGGCTGAGCGGGCCGACAAGCTGGACCTGATCAAGTTTATCCTGGAGCACTTCAACGTGCGGGAGGAAGAGATGAT
TACGATCCACGCGCCACTGTCGGCACTGTCGGTGCTCTGCATGCTGGAGAACACGAAGCAGCAGCAGCAGCGGCCAGCAG
CAGCAGACGGGATTGCGGCACAGGCACTGGGCATAGCGGTCGAGTTGCTGGAGCTGGTGCCCGAGCGGGCATTCCACGTG
ACAGAAGAGAAGGATTCGGGGAATTCGGGGAATTTTGGAAATGTTGAGAATTCGGAGATTCTGAAGCAGATCCACGACTT
TTACGTCAACGAACAGGGCAGCCTAGACACGGCATCGCCACCATACGGAACAAGAACAGTGGCAGAGCTGCTGCTGCAGA
AGGCAAGTCATCTGAGCTGCCAGTCGCTGCTGGCGGAAGGAAAAGGCGACATGGGAGCGGGCGAGCTGTCGCTGAACAGC
CAGGTGCTTCTGCTGCTGCTGGACAAGATCCGGCCGTCGTGCCGGTTCGACGTGGCCGGGCTGTTGGCGGGGCTGAACGG
GTGTCTGGGTCGGGGTGTGCGGGTGTTCTCAGTCTTCTCAGAGGTGCTTTCGCTGGCGGTACACCTGCACATCAGCGAGC
GGATCTCGACGGCAGCGCTGTCGTCGATGGTGCCGGGACTGGTGGCTGCCGCATGGGGCTTCCTGGCGGCATCGGAGCCG
CGGCACCACGTCGAGACAGTCCGGCGGCTGTGGCTGCTGCAGACGGCGCTGGGGGTGGAGAGCCGCGACGTGGAGGCAGC
AGTGGCGAGGCTGGTGGTGCAGGACGACGTGCGCGGGACGTTTGCGACGCGCAGCGCGGCGGCCGGACGGACATTTGCGG
TGCTCTGGCTGCACACGCTGCAGGACAGCCCGCAGGTGGCGGAACGGCGGACGCCGCGGACACCCAAGACGCCCAACGGC
AATCTGCGGTCGTTTCCACGGCTTGCGGGCGTGGACCACTGCGGCGTGATGCTGACGCGGCCGCTGCTGCTTATGTTGGA
CGCGCTGCTGGATGAGCGCACGCAGCTGTTCATGACGGTCAAAGCCTGGCTGAACACGATGGTCGGGATCGACCGGCTCT
TTGGCATCCTGCTGGAAAAGCTGCTGGTGTTTGTGGGCGACGACGGCGAAGGCGAGGACAAGAAGGGCAAGAAGGACGAC
CAAGACGACGAGGACGACCGGGATCTCGACATGTGCCTCTACTACCTCCGCACGCTAGCCAACGTGTTCCGCTGGGCGCC
CGGCAGCATGTGGACGGTGCTGGCACGGCGGATGGTCCCCGAGGATGTGCGCAGTACAGCAGGGAGCTTAGGTAAGCACA
TTAGTCAGCACTTCACGTGATCTGTCCGGGTGCACTAACGAGCCAATCCACAGTGCCGTCAGCCGACGAGGTCAGCCTGC
AGGAGATGCTGGTGCACGTGTGCATGCGGTGCATCCAATCGTCAGGCCTGTCAGGCGGAAAGACAGAGGACACGCAGACG
GCGCAGCTATGCCGGCAGGCGCTGACGGTGCTGCACCAGATCCTGCTGAACCCACACGCGGCGCTGCTGGGGCAGCTGCA
CCTGGAGGAGGCGCTGCTAGAGCGGCTACAGCCGTCGCTGGAGGGTGCGGACCCGTTCATTCAGGTTCTTCTGCTGGACG
TGCTGTTTGCGTCGCTGAAGCTGCGGGAAGCAGTGGCAGGCGAGCGGCCAACTTCAGCCACAGGTGACGAAGGCAGGTTG
ACGAATGCGGGAGGACAAAGCCAGGGACAGATGCAGGGAAGCCAAGTGGACGGAGCAGCGAGCACGGGCAGCACATTGGC
GGTGGCGGGTGGGAACAACACGGTATCGCCACCGGCCGGACTGCTGCGCTGCATCCGAGACGGGCTCTCAGCGCCTTGCA
GCCGGGCAGTGTTGGACAGCTGGGTCGGGTTTCTGGCAGCGTGTCTGCCGCTGTATGCGGAGTCGATCTTCCAGGTGCTG
ATTCCGCTGGTGGAGACGCTGTGTGGACAGATTGCGAGCACGTTTGGGGAGCTGCAGGAGGTATTTGGAGGGACGACGAC
AACGACGACGACGACGACAGCAGCAGCAGCAGCAACGGTTCGGAAACAGACAGATGCACCAGAGGCTACGCTCGTGTGTC
TGCTCAACGCACTGGAGCAGCTGCTGGCGACGGGTCACCAGCAGCTGCTGGCCGAGGAGGCGCGAACACAGACGGTCAAG
GGCCCGGACGCGCCACAGGGCTTCTTTGGGACGATTTTTGCGTCCGATGCGCCACAGACGCGAAGCGCGACAGCCAACGA
CCGGCTGACGGTGCTGCTGGCGTTCCAGGACGCGGTGCGGATCTGTTTCCGGATCTGGTGCTGGGGCAAGGGGTCGTCTT
CGTCGGGCGGAGCATCGTCCGGGTCCTCGTTCGCATACACCTCTCTCCGGACGCGCAACCGGGCACGACGTCTGCTCGAG
CACCTCTTCGCGGCCGAGACGCTCGAGTGCCTCGAGACGGCCATGGCGCTCTGGCGTGACCCGGCACTCAGCAGCAGCGT
GCTGGACCTGCTGCCGACGCTGGACGGATCGCGACCGAAGCACACGATCCCGGCCGTCTTCAACGCCATCTACAGCCGGA
CAAACCCGACAGCGCTCGAACGGTCGCGCAAGTCGACGCTGACCGTCTCGCTGCAGGATGCCGACATTGTCGTCTTTCTG
GTCGACTATGCGCGCTCGCTCGAGGACGACGCGATGGATGAGATCTGGCAGGACTGCACCACCTTTCTCAAGGACCTGCT
GGCCAACCCGTTTCCACACCGGCAGTCGCTGCCGAGTCTGCTCGAGTTTGCCGCCATCCTGGGCGAGAAGGTGGACAATA
CAAACTTTGGGGAGCAGCGGAAGATGCGAAGAGAGTTGGGGGTGAGTTTTGGATTCCTTTTTCCCTTATTCTCGTATTTC
CTTCTTATATTCTTCTCTTCATCCCTCTCTCTCTGTACTAACCTCCTAGGACCTCTTCCTACGACTCCTCACCGCCCTCT
TCACCACCCGACCGGTCATCTTCCCCGACGGGTCCGAAAAGACGACGCCAACAGCATCGACGCCCTCGGCCGCCGACCGG
GCTGACGACATTGTCGGCATCCTCGCAGCCATCGTGCCGAACCTGCCCAAGATCGTGACGGAAAACGACCGGGTCCTGGC
AGCGGCCACGGCCATCTCGGCCAGCGTGATCGGTCCGACTCTGCGTGCCAAGACATTCCCCGACACCATGTCGGCCACGA
CGCTGGTGCTGCTGCAGGGCCTTGCACAGCTGCCCAACAACCAAAAGGTCTGGAAGCGCGACGTGGCCGAGGCCTTCAAC
GACGCCCGCTTCTTCGGCTCGAACCTGGTCCTGGTGCGCGACCACTGGCTCGGCCTGCTGCGACTCTGGGCCGTCAGCGA
CAAGGACCGCATGCCAGAGCTGTTGGGCCGCATCACGGCACCGACCACGGCCGGCATCGTGTTTGGCGTCGGTGCCACGT
CAGCTCGCCTTGACGCTGATCGTCGTACCCAACTCAACCTCCGTCGCGTCGCCGTGCTGCTGCTGGCTGCTGCGTCCGAT
GCCTTTGTCGCCGATCTGCCGACCATTACGGACAAGCTGGTCGAGTTGCTGACTGCCTCGCCCACGTCGTCGCCCTCATC
GGCCACACGGCCCGACGTCTACCTCGTGCTGCGCGCCCTCGTTCTCCGCGTGTCGTCCGTCCATCTCGCCGGACTCTGGC
CCGTCGTTGATGCTGAGCTGCACGCTGCCATCGCCTCGACCGTCGCGCCTGACAGCAGCCCGGCCGCTGACACGTTTGGC
AATGCCGCCCTGCTGCAGGCCTGCAAGCTGCTCGATCTCGTCGTCTGTCTCGCGCCCGACGATTTTCAGCTGCGCGAGTG
GCTCTTCGTCTCCGACACCATCGACGCCATCTATCGTCCGCCCGCCTGTCTGCCTGTCGCCCTGGCCGACGAGCTCGCCG
AGGCTCTTGGTTCGGGAGCCGCGCCCGGTCCTGCTATCGAAGACGTCACCGCCCTGGCCACCACAACTTATCGTCGCCGC
CCGCTGCTCGCTGCCGTTGGCGCCGGCCTTAGCGATGATGTCAGCCTTGAGCGCAAAGACGAGCTCGTCTCCAAGGTGCT
CCGGCCCTTCTTTAGCCAGCTCAGCATCTACGCCTTTGAGGCCACGTATGCCATGGGCCCGGTCGATCTGCAGGCCTGTG
TCGATGGCGTGCTCAAGGACCTGTTTGACGACCGGGGCATTGCCCGGGGGTTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62