GenePrediction:GLEAN_8217 Details

Name: GLEAN_8217
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:276165..274898 (- strand)
Length: 1268
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:276165..275929 (- strand)
Length: 237
Type: CDS
Source: GLEAN
Position: GCSC_113:275870..275787 (- strand)
Length: 84
Type: CDS
Source: GLEAN
Position: GCSC_113:275728..274898 (- strand)
Length: 831
>GLEAN_8217 class=GenePrediction position=GCSC_113:276165..274898 (- strand)
ATGCCAGCAGTCGGAAGGGCCAAAGACAGATGGCCAGATCAACAAGCTCGACAGCACCAGCCGGCCATGTTCAACGCGCT
CAATCGGTTCATCTCGCGCCTTGACGGCGATGGGCCCGCCGCACACCGCGACGAAAGCCAGAGCACCTTTGGCTTCCAGG
TCCTGCGGAACACGAACCTGCAACTGGCCATCGAGCCCTGGTTCGACTTTGTCATCGGCATCAATGGCCGCATGATTGTA
AGCGCAGCCCGGCCGGTCTGGTCTGATCGGGCCTGGCGTGGCTGACAGCGAGCAGGACGACTCGGACCCGCACCTGTTTG
CCCAGGAGGTGCGCAACTGCGCCGGCAGCAGCGTCCTTCTCGGCCTCTGGAGCGCCAAGGTGTGTTTGTGTGTTTGTGTG
TGATCTGCGTCTGTCTGCAGCGTCCACTGACGGCCAGGGTCAACGTGCGCGCTCCATGCACGTCCCGGTTCCCCCCGACA
CGGCCTCTCTCGGACTCGCGCTCCAGTGGACGCCGTTGTCCGTGGTGTCCAACATCTGGCACGTGCTCGACGTGCCGTCG
CGCTCGCCCGCCGAGACAGCCGGCCTGCTGCCCTATAGCGACTATATTCTGGGCACGCCCGAGGGTGTGCTACACGGCGA
GAGCGGTCTGGGCGAGCTGGTCGAGGACCACATCGGCCGCCCGCTGCGGCTCTGGGTCTACAACCACGAGTACGACGTGA
CCCGCGAGGTGACCATCCAGCCGAGCCGCGATTGGGGCGGCGAGGGTGCTCTCGGCTGCGTTCTCGGCTATGGTGCCCTG
CACCGCCTGCCAGCACCGCTGAGCGAGCCCGTCAACGGCCCGGGCGAGACCATGTTCGATGGCGATGCCGACAAACACCA
CCTGCACGCGGCCGTGATCCCGTCCACAGACCTGTTCGAGCCGGCCGCTTTCGCCCCCCCGCCTACCTCACCGCCTGCCT
CGTCCGACCAGCCAGATCACTTCCTCGTTCCTGCACAGCTCGTCGTCCCGCCACCGCCACCGCCACCGCCTGCTGGCACT
GCTGCTGCCGTGCTGCGCACCAAGAAGAAGGATCGCCATCACGCCAGCAATGCCGGTCTCTCCATGGACGACTACTTCAA
GGAGGAGGAGCAAAAGAGCCAGCAGCTCGACAACGCCCCCAGCCCTTATGCCACGCCCATCGCCCCCCCACCAAAGGCAC
CGCCGCGAACAGTCACGCCCAAGACCGGCGACAGCGATGTCGCCAGCGAAGAGCCTGCCTTGGAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62