GenePrediction:GLEAN_8218 Details

Name: GLEAN_8218
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:274615..273394 (- strand)
Length: 1222
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:274615..274513 (- strand)
Length: 103
Type: CDS
Source: GLEAN
Position: GCSC_113:274448..273394 (- strand)
Length: 1055
>GLEAN_8218 class=GenePrediction position=GCSC_113:274615..273394 (- strand)
ATGGGCAAGTCGTCCAAGGACAAGCGCGATGCGTACTACCGGCTGGCCAAGGAGCAGGGCTGGCGCGCCCGCAGCGCCTT
TAAACTGCTGCAGCTCGACGAGGGTACGTCTCTGATGATCGGGATGCCTTTTTCGCCTGCAGATCCCCTCGCTGACATCA
CCGGCAGAGTTCGACCTCTTCTCGGGCGTGACCCGCGTGGTGGACCTGTGTGCGGCGCCTGGCAGCTGGTCGCAGGTGCT
GTCGCGGGTGCTGATCAAAGGCGAGAAGTTTGGCCGCGCCGCCTGGCAAGACCGCGAGGCCGAGCTGCGGCAACAGATGC
TGGGCGTGCTGCGGATGGACGGCGGAAAAGAGAGGGAAGACAGCCGGGCTGCGAGCACGACTTCCCTCCCGTCCACCATC
CGCTCAGACGTCAAGATCGTGTCCATCGACCTGCAGCCCATCAGCCCGCTGCCGGGCATCGTGACCCTGCGCGCCGACAT
CACCCATCCGGCCACCGTGCCTCTGCTGCTTCAAGCTCTGGATCCTGAGAGGCAACAGCCCGACAGCGAGGACACGTCCG
ACAGCACGGCCGCCATCGTCGCCGACAACCCGGTCGATCTCGTGCTCAGCGACGGCGCCCCCGATGTCACCGGCCTTCAC
GATCTCGACATGTACGTGCAGTCGCAGCTGCTCTTCGCCGCCCTCAACCTCGCTCTCTGTGTCCTGCGGCCTGGTGGCAA
GTTCGTCGCCAAGATCTTCCGCGGTCGCAACGTCGACCTGCTCTTCGCCCAGCTCAAGCTCTTCTTCCGCCGCGTCGTCG
TCGCCAAACCGCGCTCTTCGCGCGCCAGCAGCGTCGAGGCTTTCATCGTCTGCCTCGACTTCTGTCCGCCTGCCGGCTTT
CGCGCCAGCCTTGAACGTCCACTCGGCATCGGCTACGACAACCATATCACCGCCGACCCGACCGTCGATCTTGGCCCTTC
GCCTGCCGTTAGTAGCAAGGTCGATGAAATCGAGTACGAGGACCTCACCACCAATACCAGTGGCCGCGACGCCCGCTGGA
TCGCCCCCTTTGTGGCCTGTGGCGATCTATCGGCCTTTGACTCGGACGCTTCCTACAAGCTGCCCGAAGATCACGTGTCT
CTTGATCCCGTCCAGCCACCCACAGCTCCCCCGTACAAGAGGGCGCTGGAGATGCGCAAGGCAGCCGGTGGCGCCTACGG
AAAGACAATGGCACGCGCCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62