GenePrediction:GLEAN_821 Details

Name: GLEAN_821
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:232915..234353 (+ strand)
Length: 1439
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:232915..233094 (+ strand)
Length: 180
Type: CDS
Source: GLEAN
Position: GCSC_132:233214..234353 (+ strand)
Length: 1140
>GLEAN_821 class=GenePrediction position=GCSC_132:232915..234353 (+ strand)
ATGAGTCGCATTGTGATATACAACACGACCGTCCTCACATTGGACGATGAGGATACATTCTACTACCCGGGCACCGTGGA
AATTGTCAACGACCGCATAGCTGGCGTCTATGGAGGCAGCCCCAGTGCCGAGAGTCTCACGGACCCTACCACCACAGTGA
TCGATGGCACCGATAAGCTGGTCATGCCGGGGCTAGTCGATCTACATTTCCACACATCTGTGGCCAAGGCAAGCCCGTCT
CCGAGGCGCAGCAGCCGGACTCGACAATCTACCGGGTAAACTGACGCAAGATGGGACAGGGCTTCGGCGATGAGCTTCCG
CTGAAGGAATACTTGGAGGAGGTGTGGTATCCGAGCGTGCGGGCGCTGAATGAGGAGCGCACGTTTGTGGCAGCGATGCA
CTCATACTGCGCGGCGCTCAAGTCGGGTACAACGACGGTGAACGACATGTACCGCTTTGTAGGCGCGCGAGTCAGAGCGG
CTGATGAGATTGGCATCCGGGCGACGCTGGGCGGCGAGATTGCGCTGGCCGAGCACGGGCTGGACTCGCTAGCGGACAAC
GAGGCGGCCTTTTGGGCACACAACAAGCAGCAGCGGCTGTCGTCCTCGTCGGATGGCCGGGTGCGCGTCTGGCTAGGACT
CGAGTGGATGTTGACGTCAGACTTGGCCCTGCTACAGGCAGTCGGCCGGGCGAAGAAGGCACTGGGAACGGGACTTCACC
TGCACCTGTGTGAGTCGGAGGGCGAGGTGGTCGAGACAAGGGCATGCTACGGTGGCCGATCGCCCGTGCAGCTGGCTTAC
GAAGCCGGCTTGTTGGGTCCGGACACTGTAGCGGCCCACTGCGTGCACCTGGACGACGAGGATGTTCAACTGCTCGCGGC
TACGGGCACTTCCGTCTCCTACGACGCCGGGTCCAACGCAAAGCTCGGCAACGGCATTGCCCGGCTGCAGGATTTGCTTG
CGGCCGGCGTCAATGTCGGCATCGGCATCGACGCGTTCGAGTGCGAGAACAGCCCAGATATGTTTGCCCAGATGAAGATC
GCCTCGCTCGTTCAGCGAGCCCTCCACCGCGATGCCTCGCTGGGCCGTCCGCATGAGATCCTTCGCATGGCTACGCGCAA
CGGCGCCCACGCGCTCGGCATCGACGCCGGTGTTGTTCGCGAAGGCGCCAAAGCCGACCTCATCGTGCTTGACCTTACGC
ACAATCACATGTTCACCCCACTGCTCCACGACCCCGCCCGCCGCAAGACCATGCTCGAGAGCCACCTCGTGTTCGGATGC
AACGGCTCGGCCGTGCAGCACTCCATCGTCGATGGCAAGATCGTTCTCAGAGACTTCCAAATCCTCGCCATCGACGAAGA
AGACTTGCGCAAACAGATGGACGCCCTCTTTGAGGATATCGCGCGCGAGATGCCGTCGCTCGTCCGTAAAGTAAACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62