GenePrediction:GLEAN_8220 Details

Name: GLEAN_8220
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:269641..265093 (- strand)
Length: 4549
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:269641..269465 (- strand)
Length: 177
Type: CDS
Source: GLEAN
Position: GCSC_113:269388..269338 (- strand)
Length: 51
Type: CDS
Source: GLEAN
Position: GCSC_113:268777..268693 (- strand)
Length: 85
Type: CDS
Source: GLEAN
Position: GCSC_113:268530..268456 (- strand)
Length: 75
Type: CDS
Source: GLEAN
Position: GCSC_113:268388..265447 (- strand)
Length: 2942
Type: CDS
Source: GLEAN
Position: GCSC_113:265402..265270 (- strand)
Length: 133
Type: CDS
Source: GLEAN
Position: GCSC_113:265211..265093 (- strand)
Length: 119
>GLEAN_8220 class=GenePrediction position=GCSC_113:269641..265093 (- strand)
ATGGCACGCGAAGGCACCAGGTCGCAGACCGGCAGTGCGACACCGCGTGTCTTTCACGCCATCGACACGGCGCCCAGCAT
CGTGCGCAAAAGGGCCGCCAAAGCAGCCACGGCGAAGCCCACCGGCGTCACCAAGAAGAAGGCCCTCAAGAAGGAGCCCG
GCCCTGTCGCCAATAAGGTAAGATAAGATACCACGAACCTGGTTACCGGCAGACTATGCTGCTGTCTCTGATCCTCGCTG
ACCCCAACTGCAGGTCAAAACAGCCGCCAAAAAGGTGGTGGACAAAGCTGCCAAGGTTGAAAAGGTGAGCAGCTGTCCCT
GGAAATCGGCCGTGCAACCCATCACTGACCGTACCAGAAGCCCAAGAAATAGCAGAGAGAGGGATGGCCTGTCCGGCGTG
CATGTCCGACCGGTTGTCTGGCTGATAGGTCGATGTTGCGCTGGTATTCTTACTTGGGTGATCTGGCAGCGTGATATCTG
GTCGCAGATTCTGTACGAAGGGCAGCTGGACGTGCTACCCGACCAATGTATCTTGCTTTTGTTTTTCGTATGCAGCCGCG
TTCAATATCCATATCTTGCCATGCCTCCCGTCTCGTCTCGCCATCCATCCCATGTTGCGATGCTGCACTAAATCGCCAGT
GCAGCCTTGTGGAATTGTTGCAGTTATAGGGGCAGGTCCCCTATAACGGCCCCCCTCTGCCCAGCCAATCAGCAAGCTGG
CAGGGCACTCTGGCAGCTTTCCAGGAGCTCTGACGGGCCCTAATGGCTGATCGCCCGCCCCTGGCCAATCAGGCCTCGCA
CCATCTGTGTTTTGCGCGACCGGCGACCGGCGACAAATAAATCAAGATACAATGTCAAACAAAGGGATCGCTGCTCGCCC
AAACGGCCATCGCGTCTCCACCACCACGCACCACCACGCACGCTTCAGCGACAGGCGCTCAAAGACATGGTAAACGAGGC
TGCCGACACCGCCCACCATGCATGTTATCAAACCGTCGTGGCTGAGCCATAGTGGTGAGTGAGATCTGGGCGTGAGCCAT
TCGCTTGAGCAGACAATGACGATGCCAGGTGAATGCATCTGGTGCGGACTGCTGACAGGACCGTGTGGCAGGCGAACAAA
AAGACTTTGAGGTCTACAGCTGTCACGTCTCTTCCGATGGCAAGCGGCTGGCAACAGCCGGTGGAGGTATGTCTTTTTTG
TCGAATCTCTTCCTCGAATTCCACTCCCGTTCTTGTGCCTCGCTGACGGTCAGACGGCCACGTTCGGGTGTGGTCGACCG
AGTCCATCTACCGATCCGACGACCCGACGTACACGAAGCCGCGACAGCTCTGCCACATGAGCCACCATCTGGGCACGATT
CACGCGGTGCGGTTTTCGCCCAGCGGCCGCTACCTCGCGTCAGGCGCCGACGACAAGATCATCTGCATCTACCAGCTGGA
CCCGAGTCCGCCGTCGCACGCGGCGTCGTTTGGCACGTCCGAGCCGCCACCGGTCGAGAACTGGAAGACGCACCGCCGGC
TGGTCGGCCACGAGAACGACGTGCAGGATCTCGCCTGGTCCTACGACTCGTCCATTCTCGTCTCGGTCGGCCTGGACTCC
AAGGTCGTCGTCTGGTCGGCACACACGTTTGAGAAGCTCAAGACGCTGTCAGTGCACCAGAGCCACGTCAAGGGCGTCAC
CTTTGACCCGGCCAACAAGTTCTTTGCTACGGCCAGCGACGACCGCACCATCAAGATCTTCAAGTTCACCCCGCCGCCAC
CCCACGCCACCCAGCATGACCTGCTCAACAACTTTGTGCTTGAGACCACCATCAGCGCACCCTTCAAGAGCTCGCCGCTG
ACCACGTACTTCCGCCGCTGCTCCTGGTCGCCCGACGGGAACCACATCGCCGCTCCCAACGCCGTCAACGGTCCTGTCAG
CTCTGTCGCTATTATCGAGCGCACCCGCTGGGATAGCGAGATCAACCTGATCGGCCACGAGGGTCCCACCGAGGTCTGTA
TGTTCTCACCGCGTCTCTTCTACACCAAGAAGCCGCCATCGGCCAACGAGGCCAACGGGACGCACGACCGCGAGGCCGAG
AGCCTGGTCACCGTCATCGCCTCGGCTGGCCAGGACAAGACGCTGAGTATCTGGAACACCAACACGTCACGGCCCGTTGT
CATCCTGCAGGATCTCGCGGCCAAGTCCATCTCGGACCTCGCCTGGGCACCCGACGGCCAGACCGTGTTTGCGTCCAGCC
TCGACGGCAGCGTGGTCGTCGTCAAGTTCGAGGAGGGCGAGCTAGGCTGGGTCGCCCAGGTGGAAGAAATTGACAAGGCG
CTGCAGAAGTTTGGCGCCTCGCGTCGGGGCGTCGGCATCGCTGAAGATGTCGAGGGTCTGAACCTCGAGAAGCACAGCAA
GGCAGGCGAGCTGCGCGGTGCCGAGTCGCGGATGGGCGCCCTCATGGGTGACGGACAGCTAGCCAAGGCCAAAGACAAGG
ACAAGGACAAGGATCGGGAAAAGGATGGCAGTGGAACCAGCACGCCACAGAACGGCAGTACGGCAGCGAACGGGAGCACG
AAGACGGCGAGCAGCAAGGCAGGTGAGACAAACGGTAGCACGGGCAGCTCGGAACACGCAAATGCGAACGACAGCACCGA
CAAGAAGGAGGAGAAAGAGGCAGCAGCACAGCGAGCAGAACGGATCCAGACACTCAAGTCACGTGTAACCATTACTAAGG
ACGGTAAGAAGCGGGTTGCACCACTGCTGGTGTCGTCGTCCGGGACGGGACAGTCATTGCTGCCACAGTCACAGTTTGTC
GGGACGAGCAGCTCGAGCAGGACGGCACAGAACGAGGCGCCGCAGACGATCCTGGACCTGTCGCGGCCAGTAGACAGACT
GCCGAATGGCGGGATCGCCTCGATGCTGCTGGGAACGAAGCGGAAGGTGGTCGCACTGGAGGGCGAAGAAGACGGGACGG
CCAAGCGGTCTTCGTCAACAAGCGGCGGTGGGGTCGGTGGAGCGCTCGCAGGCACTGGAACGGCCATCCTGGTCAACGGA
GTCGATGGGGCTGAACCGGCAACGCTGCAGCCAGCAGTCCGAGGAGCAGTGGCGACGCCCGAGTTCCTGCGGCCAGCGGT
AATCAACCCGTCGATAGCGATCTCGCAGGTGCGGCTCGCAGTGCCCAAAGTGCGCACACACATTCTGCGGGCGCTGGAAC
GAGGCGTGTTGCAGGCACAGGGCAACAGCGCTGCTGAGGGCAATTTGGTGCTCGAAGCCCGCAACCCGGAGACGCGTGCC
GTGCGGGAGCCGGCTCACGTGACGGTGACTAAGCGAGGCAACGTGGTGTGGCAGGACTTTCTGCCGCGAGCAGTGCTGCT
GGTGACAGGAAGCCGGTACTTTTGGGCTGCAGCATGCGAAGACGGCACCGTGTGCATCTGGACGCCGGCCGGACGGCGGC
TGGTGAGCGCGATGGTGGTAGAGGCGCAGCCGGTGATCTTTGAGAGTCGAGAGCACTGGCTGCTGTGCATCACAGCCGTC
GGTCTGGTGCACGTATGGAATGTGCAGACGATGGCGTCACCACATCCACCAGTGTCGCTGGCGCCAATCCTGGAAATTGC
CATCCACTCGCTGCACGCAAACGCACAGACGGCAACGGCCGGGCCAGGCGTCACGTCGGCACACCTCAACACAAACGGCC
AGGTGGTGGTAACGCTGAGCAACGGCGATGGCTACTGCTATGCGACGAATCTGCACAGCTGGCAGCGTCTGTCAGAGTCG
TGGTGGGCTGTTGGAAGCCAGTACTGGAACAGCAACGACAGCGCCGTGAGCGCCCTGCAGACGACGGCCGTCGGACCAAC
GGCCGATGTTCCGGGCCTGGGCTTAGCTGCTTCAGCGTCCGCTTCGGCCTCCAATCCGGCTTCCGACCCGGCAGATACCA
CCATTACCGAGGCCACCGTCTCGGCCGGCATCATCCCATTCCTCGAGCGGCACACCACCGGCGAGTTCCTGCTCAAGGGC
CGTGCCTACACGCTGCAGCGCATGGTCAAGGCCCTCCTCGTCCGCGACGGCTTTGAGGACTTTGAGGCTAGTGTCAGCAT
CGCCCACCTGGAGAACCGTATCGCCGCCGCCCTGCAGCTGCACGCCCGCGACGAGTTTCGCCTGTACCTGTTCATGTACG
CCAAGCGTCTGGGTGCCGAAGGCCTGCGCGGCAAGGTCGAGGAGCTGCTGAACAGCCTGCTGGGTGGGGGTTTTTACAGG
AAGCCGTGCCCGGGTCTGCCGCTGCCGTCGCCGTCGCCAGCGAGAGTGACAGCTGGGGCTGGTTCAGCCGGACCGGTGAC
ATCTGCGGCTGGGACCGTCGGGAGCTGCTCAAGGGTGTCGTCATGATTTTGGGTAGGTTCCTCTATTTTTGCTTCTGTTC
TCTGTTTTTTCCTCTCGCTAACTTTGACAGGCAAATTCCGCGAACTGCAGCGTCTTACAGTGCAGTATGCGCGCGTGCTC
GAGCTGACGCGCGAGGATGAGGACGGCGACGAGAGCGAAGCTGGCGACTGCATGATGGTGGAGACATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62