GenePrediction:GLEAN_8222 Details

Name: GLEAN_8222
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:251448..250144 (- strand)
Length: 1305
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:251448..251266 (- strand)
Length: 183
Type: CDS
Source: GLEAN
Position: GCSC_113:251193..250715 (- strand)
Length: 479
Type: CDS
Source: GLEAN
Position: GCSC_113:250645..250144 (- strand)
Length: 502
>GLEAN_8222 class=GenePrediction position=GCSC_113:251448..250144 (- strand)
ATGACGGATCCAGCATTCCCCGGCCTTCGGGGATATGACCCCGACAACCTGCAGCACTGGACGGTGGGCGTGGTGACGGC
GATGACAGTGCTGGCCACGCTGTCGGTGGTTCTGCGACTTGTCAGCCGGTACCTCAAGGGGCAGTCGTTATGGTGGGACG
ATTACGCGATCATATTCTCCTTGGTGAGTAGGCCGTCGGACAGCCCCAATCCGGAGTATCCGAATTTCGCGAAAGCATTT
GTTGACGAAGGACAGTGCTGGAATTACGTCGTCGTCGGCTTCATATTTGCCATGTACGCCGAGGGAATGGGAATCCATGC
AGACAAGGTGTCGACGGACAAGATCGTCATGATGGCCAAATGGCTTCTGGTGGCAGAGATTCTGTATGCATGGAACCTCT
GCTGGACCAAGATCTCGCTGCTGCTCATGTACTACCGCATCTTCCACATCCGGTTCTTCAAGAACATGGCCTTTTGCATC
GGCGGCTTCGTCCTTTGCTGGGGCGTCACCGTGACCTTTCTCTTCGTCTTCATATGCGTGCCGGTGGCGAAGCTCTGGTA
CCCCGACCTGCCGGGCCACTGCATCGACCAGGTCGGCACCTGGATCGCCAACGCGACCTCGACCATCCTGACGGACCTGG
CCATCTTGGTCCTGCCGATCCCGCAGATCTGGAAGCTGCAGCTGCGGCGGGCCGAAAAACTGGCACTGACCGTCGCCTTT
GGCCTCGGATCCTTGTAAGTGCAGCCAGCGTTCGCTTTTTGCTTCGTTCATAGTCGACTTTCTGCTTACACTCCGCTCAA
CAGCGTCGTCGCCGCGTCAGCCTACCGCTTCTCCGTACTCTTCTCCTACAGCAACTCAGACCCGTCCTATACGCTCGCGC
CCACTGTCGGCTGGACGGCGATTGAGATGTCTGCCGGCATCATCTCGGCTTGCCTGCCGACGCTGCGGCCGACACTCGTG
TTCGTGTCCAAGACCCTGGGCCTCAGACTGTTCTCGACCCGCAGCGGGCAGTCAACCAATCATTCCCGAGGCGCCAACCA
GGACTCGCAGGGCCGGGTGATCAAAACAAACAATTCGGAGCTGCTCAGCGCATCGACACATGCGCAGAAGCAGAAGGCCA
AGGATGCCTTCTACCGGCTAGACGACGGGTCGAACGAGAGCCCGGTGGACGAGGGCCTGCGGCCGGCGCACGGGACCAAG
TTCACAGTGGCGACATGGCGGGATAGCTCTGGCAGCGCGGACGAGATCCCGCTGCATTCAATCCGCGTGCAAACAGACCT
GAAGCAAACGGAACATGATGATTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62