GenePrediction:GLEAN_8227 Details

Name: GLEAN_8227
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:233274..231822 (- strand)
Length: 1453
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:233274..233219 (- strand)
Length: 56
Type: CDS
Source: GLEAN
Position: GCSC_113:233154..231822 (- strand)
Length: 1333
>GLEAN_8227 class=GenePrediction position=GCSC_113:233274..231822 (- strand)
ATGGTTTGGCAGCACGGCGACGAGCACAACATCCCGGCGGAGCACCGACGGAACCAGTATGTTGTTTCAGACTCTCTGTG
TCTATGTCTAATACGTGGACCCTGCTGACTTGTCGATCAGTCCTGGGCGTTGGCTGCCGGCCGATCACCGGGTGCAGCAC
GAATGGTTGCACCGGCGAGTGGAACACGTTGACAACAATCCCAAGCAGGATCTGATCCCGGTGCTGCAGGAGTTCCGGGC
GTTGATCGAGACGAACCCGCGGATTTACATGTACTTTACGGAAATGTGGGACGAGGTGCCGCACACGCAAGTTTACAACC
GCGACCCGACAGGAAGCCGACAAATCCGCGACCACGGACACATGTTGGATGTGATGAACCATAGCTTCAGCAGCGCGCCC
GAGTGGACGGACGCGGCTGAGAGCGTCGGCATGGTGGGGGTTCCTTTGTGTGCGATCTTCGACTACGTGATGGGCACGCC
GAGCGGACATGCCGCCTTTCTGGACCCGGACGTGAACCGGATGCTGAAGAAGGTGCTGAACGCATGGGGCCAGTTCCTGA
AGACACCGGCGTCTGCCAAGGTGCTGGGCAGCCACAAAACCGGCTGGTTCGGCGAGGTGGGCTACAAGGACGTGATGGCC
GTGGCCAATGCGCCCTACAAGACGAGCCACCGGTTCGAGGACATGTTTGTGTGCGACCCGACGGCCGAGTACTACGGCTA
CAAGTCGTGGGACGACTTCTTCACGCGGCAGCTGCGCGACGAGGCGCGGCCGGTGGCGGCGCCGAACGACGACAGTGTGA
TCGCCAACGCGTGTGAGAGCCGGGTGTTTGCGGTGGTGCGCGGAGCCCAGCTGCGCGACAAGTTCTGGATCAAGGGACAG
CCGTACAGCGTGCTGGACATGCTGGCCCACGACCCGCTGGCGCAGCAGTTTGGCGGCGCCACGGTGTACCAGGCCTTCTT
GTCGGCGCTGTCGTACCATCGCTGGCACGCGCCTCTGTCAGGCACCGTGAGGCGGGCATTTGTGCAGGACGGCACGTACT
TTAGCGAGCCGCTCTTTGAGGGCGTCGGCGACCCGGAAAACGCGCGCAAAGAGGGCACGGCAGACGAGGACAAAGCGATC
GATCCGAAAGGCATCACCGTCGCCCAGGGCTATCTGACTGCGCTGGCCACGCGGGCGGTCGTGTTCTTTGAAGCCGACAA
CGCTGACATTGGCCTGATGGCTTTTATCGGTGTCGGCATGGACGAGGTCAGCACCTGCGAGATCACCGTGCGCGAGGGCC
AGCATGTCACCAAGGGCGATCAGATCGGCATGTTCCACTTTGGCGGCTCGTCACACGTCCTGCTGTTCCGCAAGGGTGTC
AAGGTCGACGGTTTCCCGCAACCGGGCGGCGAGGTCAACGTGCCGGTTCGTGGACATCTGGCCAAGGTGCGCTCATCGGT
GTCAAAGGGTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62