GenePrediction:GLEAN_8228 Details

Name: GLEAN_8228
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:231068..229937 (- strand)
Length: 1132
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:231068..230221 (- strand)
Length: 848
Type: CDS
Source: GLEAN
Position: GCSC_113:230159..229937 (- strand)
Length: 223
>GLEAN_8228 class=GenePrediction position=GCSC_113:231068..229937 (- strand)
ATGAGCCGCGAGATCACGACTGTGGTGCTGGCCGAGCGGCCCAAGACCGTCGTCGTGCCGGGCGAGACGTTCCGGGTCGA
GAAGGTGGCCGCACCGACCGAGGCCGACCTCAAGGACGGCCAGCTGCTGCTGGAGACGCTCTACGTCAGCCTGGACCCGG
CCATGCGCGGCTGGCTCAGCACAGAGCGGTCGTACATCCCGCCCGTGGCCATCGGCGCCATCATGCGCGCCGGCGCCATC
TGCCGCGTGCTGGCAACGCGCTCGGCCAAGGCGGCCGTCGGCGACATCGTCACATCCTTTTCCGGCTGGACCGAAGTGGC
CGTGGCCGAGGAGGCGACGGTGAACAACCTGTTTGCGGCGCTGCCAGCTGAAGCCCGCAGCCAGCTCAGCATGACCGACC
TGATGGGCACTCTCGGCATGACCGGCCTGACCGCCTACTTTGGGCTCGACAAGATCGCCGGCCCCTTCAAGCCGACCGAC
ACCGTGGTCGTGTCCGGAGCCGCCGGCGCCACCGGCAGCATCGTTGCCCAGATCGCTAAGCTCAAGGGTGCCAAGCGCGT
CATCGGCATCGCCGGCTCCGAAGAAAAGGTCCGCTGGCTCGAGGACGACCTCAAGCTCGACGTCGGCCTCAACTACAAGG
ACCCCGACTTTGCCAAGAAGCTCCGAGACGCCGTCCCCGACTTTATCGACGTCTACTGGGACAATGTCGGCGGCGAGATC
CTCGACTTGGCCCTCAGTCTGGCTGCTCCTCACTCCCGCTACGTCATGTGCGGCGGCATTAGCCAGTACAACTCTGGCAA
TGTCCAGGGCCCCAAGAACATCCTCAAGGTCGTTACTCAGCGCATCAAGTAAGCATCTCCAACCACCCCTCGCTTTCTTC
TGCCCGACACATGCTGACTCTCGACGCAGGCTACAGGGCTTCATCGTCATGGACTACGCCACCGAGTACGAGAGGGCGCT
CAAGGACCTCGCCCAGTGGCTGCTCGAGGGCAAGCTTAAGCGGTCCGAGACCATCCTTACCGGCGGCCTTGAGGTGGCCG
ACCGGGCCCTGCTGGACCTGTTTGAGGGCAAGAACAAGGGCAAGCTTCTCCTCGAGGTCAAGAACCCCAAGGACGAGGCG
GCGAGGTTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62