GenePrediction:GLEAN_8229 Details

Name: GLEAN_8229
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:227195..225386 (- strand)
Length: 1810
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:227195..226863 (- strand)
Length: 333
Type: CDS
Source: GLEAN
Position: GCSC_113:226792..225617 (- strand)
Length: 1176
Type: CDS
Source: GLEAN
Position: GCSC_113:225547..225386 (- strand)
Length: 162
>GLEAN_8229 class=GenePrediction position=GCSC_113:227195..225386 (- strand)
ATGCTCCGACGCCTTCCAGTCTCGCAATCTACACCGGGGACAAGCTGTCGGGCCATTCCCTCTTCTGCCTCGTCGGATGC
TCACAGAACAAGCGCCGTGAACCTGCGCAGCCGTGAGCCATCGATCGCCTCGGCCCCTCCGACATCGACTCCTCTCGTGC
CAGTGAGTGGACCAATTGACCGCGGGGACACCTCGCCGACCTCGCCGACGACTCAGACAGCAGCAGAACAGAGTCATGGC
GGCGCGTTTCGGCGGTGGTGCGCAAACGGCACTGTGCTCTGGTCGAGCTCCGACAAGTCTGTTGCGACGGCCATTGCCAG
CATCAACGACGACGTCATCTCTTTCGGCAGCAGCAGCCTCAGCGCTGTATACGGCGCACGGTTGGCCGGCCGGCCGGCGA
CAGTCGTCGGCATGGTCGGCAGCCGTGTCGGTGGCCGGCAACATCGTGTCCAATGCCATCAGCCGGGCCAAGAAGAACGA
GATGGCCATTGATCCGCTGCGGGTTGTGGCCAAGGAGATGAAGTATCTGATCGGCGACGTGCGCAAGCTCCTCGGCTCTG
GCCATCCATCGCTGGATCGCGCGGCCAAATACTACACCCAGGCCGAGGGCAAGCACATGCGGCCGCTGATCGTGCTACTG
ATGTCGCGCGCCACCTTCCAATGCCCCAAGGCACCGCCATCACAGGCGCAGTTGTCAGAGGCACAAGCTGACTGGCCGCT
GTCGCCGTCAGCAACACCACCGCTGCAGGCAGCCGCCGGCGTCGATGCCTCCATCTCTCCGCTCAATGTCCTCTCCGACT
TCAACCCGGCCTGGGGCGGCAAGTCGCCCCTCGTCGACTCCACGTCCATCACGATCCCGTCATCCTTCACGCCATCATCG
CCCTCCAGTGCTGCTGCTGCTGCTGCCGAATCAGACGCTGCTGTCGACACCAATATCCCCGATATCCTGCCATCGCAGCG
GCGGCTGGCCGAGATCACCGAGCTGATCCACACGGCATCGCTGCTGCATGACGACGTCATCGACCACTCGGAGTCGCGGC
GCGGCGCGCCCTCAGCCAACCTCGAGTTTGGCAACAAGATGGCCGTGCTGGCCGGTGACTTTCTGCTCGGCCGCGCCTCT
GTGGCACTCGCCCGCCTGCGCAACGCTGAAGTCGTCGAGCTGCTATCGACCGTGATCGCCAACCTGGTCGAGGGCGAGTT
CATGCAGCTCAAAAACACGGCCCGTGACGAGACTAACCCGGTCTGGAGCGAGGCCACTCTGCAGTACTACCTGCAGAAGA
CCTACCTCAAGACGGCATCGCTGATCAGCAAGAGCTGCCGTGCTGCTGCCCTTCTCGGCGGGGCTGATGCCCAGACCGTC
GATGCTGCCTATGCGTACGGCAAGAATCTCGGCCTCGCCTTCCAGCTGGTCGACGACATGCTCGATTACACCCGCTCAGC
CAAGGATCTCGGCAAGCCGGCCGGTGCCGACCTCGAGCTCGGCCTGGCCACCGCTCCGCTGCTGTTCGCCTGGCGCGAGA
ACCCGGAGCTCGGTGCCCTGGTTGGCCGCAAGTTTGCCCAGCCAGGAGACGTTGCAAGAGTACGCTCACGCTCCCCAGAA
TACCCTCCTCTGCCACTTCTGTCCTCTCGCTGACCCTATCCTCTCTAGGCGCGTGAAATCGTCCTTGCTAGCGACGGCGT
CGAGCAGACCCGCGCGCTCGCTCAGGACTATGCCGAACAGGCCATTGCGGCCATTAGCGCGTTCCCCGAAAGCGATGCCA
AGAACGGCCTGGTCGAGATGGCCATCAAGACGCTGAAGCGCCAGAAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62