GenePrediction:GLEAN_822 Details

Name: GLEAN_822
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:234698..235782 (+ strand)
Length: 1085
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:234698..234947 (+ strand)
Length: 250
Type: CDS
Source: GLEAN
Position: GCSC_132:235042..235102 (+ strand)
Length: 61
Type: CDS
Source: GLEAN
Position: GCSC_132:235161..235782 (+ strand)
Length: 622
>GLEAN_822 class=GenePrediction position=GCSC_132:234698..235782 (+ strand)
ATGGGCAGCCTGTCTACAGAACCGAAAGATGCCGCCCGTGTGGTCACTCTGTCGGCAGAGGAATTGAAAAGGGGCGCCTA
CGCACCGCTGTCGCTGATACGTGCATTGGAAGCGTTGCATCAGGATGGTCTTGTCGTTCTCCGGGGTGTCATCCCTGTCG
ATCATGTGGACTCCCTCAACACAAGGATGTGCAAGGATGCTGAGGTGCGGCTTGCCGACAACAGCCAGGACTTCAACCAC
AACGTCAAATGTACCTTCTATCTACCCGCCTCCCTCTCCTGCAGGCTCTCTCCAGGCTGACCGTATCCGAAGCCAACTTT
CTGCAACGGGCCCGCCCATCACAGATACTGAATTACTGTATGAGGACGTCTACTTCAATCCGTTTGTCCTACAGGTGGGG
AATGCGTATGTCCCGGCTACAAATCGCTCAGCATGGGTCCCATGCAACTTGCTGACCGTCCAGATACCTCGGCCATCGTC
CTATCTGGAACTGGCTGACAGCCAACACGGCCGTGGCCAACACGGCCGGAATGCGACAACCAGTGCACAAGGACTGCGCC
TTTGAACACCCCATGTTCCCCTACTACTTCATCGCCAACATCCCGCTCTGTGACTTCAGCGAGACCAACGGGGCCACCGA
GTTCTGGCTCGGCTCGCACGCCCACACCTCCTGGCGTGACAACGACATGTTGACCGACCTGGCCGACACGCCCGGCCCGT
TCTCGCGCCTCAACGAGCCCGTGCCCAATGTCTCGGCTGCTGCTCGCCAGGCTCGCCGGCTGGTTCGACCACCGCTCCAG
CCGTCACTGCGTCGTGGTGACATTGTCATCCGCGATCTGCGCACCTGGCATGCCGGCATGCCCAACAACAGCGACCAGCA
TCGCATCATGATCGGTCTTGGCTACCAGAGCCCCGCGCATCCCAACTACACCATGCGCCTCCACCTGCCAGCCGCCCAGC
GCTCCTTCTTCCTTGGCTCCGCACCCGCGAATGTAGACGTCCGAGCCAACGTATACTCGGACGAGGATCTGGCCGCCCTC
AAGATCGACACGTTCTTCGACCTTCGCCCGGAATATCTAGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62