GenePrediction:GLEAN_8230 Details

Name: GLEAN_8230
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:223713..221971 (- strand)
Length: 1743
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:223713..221971 (- strand)
Length: 1743
>GLEAN_8230 class=GenePrediction position=GCSC_113:223713..221971 (- strand)
ATGGTGACCACGGTTGTCTGCCCCCCGGCCGACGAGCAGCCAGCCCTGGTGGCCCTTGCGTCCTCCAGGGCCGTCCTCAC
GCTGCCGGACGATTCTCTTGTCCTCTCGCCTGCCACCATCTTGATCAGCCCCCAGACCGGCAAGATCGTGTCCATCACAC
CGCAGGTGCTGCCTCCCTCGGCCTTTGACCTGGCCGCCACCCGCTATGTGGACTACTCGCCACAGCTGCTCATGCCCGGC
CTCGTCGACGCTCACGTGCACCTCAACGAGCCCGGCCGCACAGAGTGGGAGGGTTTCCACACGGGCACGCGTGCTGCTGC
TGCCGGTGGCGTGACCACCGTCGTCGACATGCCGCTCAACGCCATCCCGCCCACCACGACCTTGGCCGGCTTCCGCGCCA
AGCTCGATGCCAGCCGTGGCCAGTGTTGGGTCGACGTGGGCTTCTATGGCGGCCTTGTCCCCGGCAACGCCCACGAACTG
CTGCCGCTGGTCGAGGCCGGCGTGCGCGGCTTCAAGGGCTTCCTCATCCACTCGGGCGTCGACGAGTTCCCGGCCGTCGG
ACCCGAAGACATCGCCACCGCCTTGCAAACACTGCGAGATGCCGACACCACCCTCATGTTCCACGCCGAGATGCTGCCGT
GCGGCACCGTCGAAACCTCGGCAGCCGATGCCACAGCAGCAGCCCTGACAGCCGCCCAAGACGGCAGACCTGATGCCTAC
GACACCTTCCTGGCGTCCAGGCCGCCCTTGTTCGAGACCACAGCAGTCGAGCAGATCGTCACACTGGCGCCGCTCGCACC
CAAACTGCACCTGCACATTGTCCACCTGTCGGCCACCGAGTGCATCCCTATCCTGCGCCAGGCCCGAGCCAACGGCATCC
ACATCACGGCCGAGACGTGCTACCACTACCTGGGCCTCGCTGCAGACGACATCCCCGATGGCGACACGCGCCACAAGTGC
TGTCCGCCCATCCGCAACCAGATCAACCAGGATGGTCTGTGGGAAGAGCTTGGCCGGCCCGACAGTGTTATTCGCACCGT
CGTGTCCGACCACTCGCCCTGCACCCCGGATCTGAAGCTTTTGCCGGGCCATCTCGAGCCAGCTCCTGGGTCTCCGAGTC
TGTCTGCCGAAGAAATCGATGGTCCAGCCCCCATGCGTCACTCCGACTCCGGTATCGATATGACCCTGCCCAGCGACGAG
ATCAAGGCCGCGACATCGGCAGTAACGGCAACCAAGGTCATCGCTGTTGAGGAGCGCGGCGACTTCATGGCCGCCTGGGG
TGGCATTGCATCCGTCGGCCTGGGCCTGTCTGTCATGCACACGGCCTCGCTGGCAAGAGCCGCGGCCAAGGACAAGCAGT
CTTGTCACAGCAGCTGTACTGGCCAACATGATTCGACGCATAGCTCGGTTCCCACCATCCTGGACATCGTCCGCCTCTGC
TGCCAAGCCACTGCGCAACAGGTCGGCCTGGCTCACCGCAAGGGTGGTCTGCGAGCCGGCATGGACGCCGACGTGTGTGT
GTTTGATGACGCCCTCAGTTGGACCCTGTGTCCGGGTGACATGCGCTGGAAGAACCGCTGTTCGCCTTGGGAGGGCCACA
CATTCCAGGGTCGCGTGCGGGCGACATGGCTGCGCGGCCAGCCTGTCTTTGAGCTCAGCGCTTCAAACGGCGGCTTCGGC
ACTGCACCACCCGTCGGCGAGGCTATTTTGGAGAAGCGACTGCCCGCAGCGCTGGCTGCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62