GenePrediction:GLEAN_8231 Details

Name: GLEAN_8231
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:215889..215416 (- strand)
Length: 474
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:215889..215615 (- strand)
Length: 275
Type: CDS
Source: GLEAN
Position: GCSC_113:215518..215416 (- strand)
Length: 103
>GLEAN_8231 class=GenePrediction position=GCSC_113:215889..215416 (- strand)
ATGCAGTTGACAGATGCGCTCGACATTTGGAAGAACGACATTACCCCGCCCACACACACGCCCCCTGATATCGCTGCACC
ATGGCGGCATTATTCCATCTCACCAGTTCAGTCAGCGGACGTGGTGCCATTGCCATGTGAGACCCTGTCTGCTAGTTTCC
CTGTTCTCAACAGACAGGAGCACTACGAGCAAGATACTTACGTCCTTTCCGACCCTCCCGCCTCGCAGCCGTGGTGCTCT
GGCATACGGGCCAATGTGCGCACTCACAGGGCGATGTGTGTGCTGGTTCGGGCGTTCTTCTCATGACGACAGCACACAAA
TACGAAATTGAATTACCGGCGGCGGCATCCCCCACTCTGTCGGAGCACTAGTTGGGCCCATCTGGTCGGCTGGTTGGCTT
ATGAAAGCGCAGAGCAGTGGGAATACGGAGTCAGCAGCGCAATGCTCAGCAAAGCGGCCACCACCGTGCAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62