GenePrediction:GLEAN_8232 Details

Name: GLEAN_8232
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:210100..200386 (- strand)
Length: 9715
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:210100..209684 (- strand)
Length: 417
Type: CDS
Source: GLEAN
Position: GCSC_113:209438..208454 (- strand)
Length: 985
Type: CDS
Source: GLEAN
Position: GCSC_113:208042..206472 (- strand)
Length: 1571
Type: CDS
Source: GLEAN
Position: GCSC_113:205716..204709 (- strand)
Length: 1008
Type: CDS
Source: GLEAN
Position: GCSC_113:204516..203263 (- strand)
Length: 1254
Type: CDS
Source: GLEAN
Position: GCSC_113:203097..202351 (- strand)
Length: 747
Type: CDS
Source: GLEAN
Position: GCSC_113:202111..201687 (- strand)
Length: 425
Type: CDS
Source: GLEAN
Position: GCSC_113:201616..200386 (- strand)
Length: 1231
>GLEAN_8232 class=GenePrediction position=GCSC_113:210100..200386 (- strand)
ATGTCTGTCCTCAGCACTGTCGTAACCGCCATCAAATCTTTAAACAGGACTTCCCCATACCAGAATATCTTGACGGTATC
CCCGGAGCAAACACAACAGCTTGAAATAGTAAAACGAGAGGATTTTCCAAATGTGCGAATGAATCTAGCGGATAACATCT
TTTTGCCCGAAGAGATGGCCGTGGCTTGGAGCCATGTTGAGACCCTGAGAGGGATCGATACGCTCACAGGCCTGGAATGC
CGTCGTCGTCAGGACCTTGAGTCTATCGCCCAGAAGCTGGGCACTCACACCTGCCAACAACTTGACATTGCCCGGCACCG
AATGGATCCTGTCTTGAATCACATTGAGCCCATGATACAAACAAATGCTGAGGCGCAGGCTCATTTTCGGACAGTCTTCC
TTGGCGCAAGGATCTGTGTAAGTTGGACCTATCATTTGCCTGAATCCGTGGCTAGAGCTGACTGGAGAAGATGATCTGTT
GGCATCTTAGGAACGGAGCCGAGCGAACATTCGTCATGCAATTGCTCAACGCATTGTTTCCACCCTACCTTATGTCCTAT
CCGGTACCATCAATTCGGGTGCAAGATATCAGAGCCCTCCGTGAACACGTTTACTATGCTCTCATGGAAACTAGAACAGA
TATGGACATCTGTGGGATTCAGAAAAGGCTGTTTTCCGAAGCCGGCGTTGCTTCCGGATGGACAGAGGAGGTCCGCCCGG
CGCTGATGGCGTACATGGCTATCATCGAAGAAACCAGGCAAACATTCATCAAGATCTGTGGCGACAGACACCACGCTGCA
CCTCCTGACGCAACCAAAGCAAGCACCAGTTCAAAATCGGAATATATCAGGTCTATTTTGAAAACGTCAACGTCATCATC
TGGCCAGAGCGTTTCTTCCTCGGGATCCTATTCAGAACTCTTGGTGCATCCTCTGCTTAGGGAACTAGGCCTCAGTGAAG
AGTCTTTGTTCAAAAAGGGCTTGCGACTTCCAGCCACCAATGCCAATCACCTTTCATTGGACAGTTCAGCATCGTCACAC
CCCCCCTTCCCAATTTGCACAATTCAGCGCGAAGATAACCCGTCATTATCTGCACTCACACAAAAATTACATGACGGTGT
TCAAACAACTTCAACCATACCTGACCAGGCATCCTTCAACTGCCATGATGTTGCACATACCCTTGAAGATTCAGCAGAGA
GAAAGCTTGCCGAAGCACCTGAACACGACATAAAGATAAATGATACCGCAACTCAAGATTGCAAAAATGGGACCCAGGAT
GAAGATGCTGAAAGTCCAGGCCGCAATCATCCTGCTTTGAAAGCTGCCAAGTCCTCAGTGACTCTTCGACAGCAGAGAAA
GTACGACACACTGCCAGAGAGGACCCCGAACTTGCTCAAGCCAACTTGGAGATCAACAGAGGGAATATTCGCCAAATTCA
GAGGACAAGACGAGGATATCAAAGTGGCTGCCCTCGGCATCCCTTCTGTTCCACTTACTGCCTCCCAACGACGCCCATCA
AAAGCGGTGCGATTTTCTGACAAGTATATGAACCTGGAAGACGGAGATGAAGGATCACCGACGACACCTATGCCGGAAAA
TACCGAGAAAAGCACCGAGGCAAGGGGAAGACAGAACACCGATCCCTGTATGCCAGGGAAAACCCCGGCCCCACAGACCG
AGCATGCCGGCACAGATCCCTGGAAGTATACTCGAGATTACCTGATAGAAAAGGTGAACTCGCAAAGAGAAGGACGTCCA
TGCACACTTCGACCGCCATCACCGGAATGGCTTCTGGATGAAGGTAGCGGTGACAGGAACTCGTTTTGGGCACGATCCCA
TCGTGACGCATTATCTAAGCTGTTCTCAAGCGGTGGGACTGAGCTATTGAAAAGAGGGTCTCCAAAACCAGGCGGAGACG
AAGAGGTTTCGGCAAACCTTGCCAAATATACGAAGGACCTGTCTCCGGTGACTGGCAGTTTTATGCAGCCCAACACGATG
GTGTCATTAGCAGCCGGTGCATAGGAAGCACCTGATGCAAATAATGGCTCATCCATAGCATCAAAAGCAGCAGCTACACT
GGGACTGCCAGAACTTGCAAAGCCGCTGCAGCAGAATCACCGAAAGGGAGACCTGTCTGCTTTGGTTCCCAATCCAAGCT
TAGATTCAAAAAATGCCACGCTGAAGGTTGGGACAAACGCTGTCGCTGGAAGTGGCTACCGGGGACAAGGTGGCGGCTTG
ACCCTGTCACCGCGACTGGGCAAGCTGGCCTTTGAGATTGCCCCATCGGAGTCGCGCAAGAATCTCGATTTTGATGTAAA
GCTCTTTCAGAGACAATCCCTTCTTGTTGCAGCGAAATCGCAGATCGAAAAAGACAGGGAAAGAATGAACAACCACCAAG
CCAGCGGACAAGGAGAGGACGGCAAAGTCGCAGGACCGGCTTCCAGCATTTCTCATTCCAGCATTCGCAGCAATGGCAGC
ACTGCAAGCACTGCAGCGAGCTTTTCTGGATTTTCCCTGTTTGGTGGCAACGACCAACAGCAGGAAAACGTCCCGTTCTT
CCATAGTCTTCGGCGGTCTTCACGCAGGCATCAGCAAATGCGCTCTGTGACGCAACCTGCGACCAGCCTTAAGGCCGCAA
TAGACCGAGGCATGAACATGGGAACGAGCCGGAGGGAGGTATCCTCCGCTAGCGAACCGGCAGCAGCTTCCTTGAAGCAA
GACGACAGCAAGGGTGACAGCAGTCCTTGTGCAACCATGGCCGACTTTGGCCTACCGCAAGTGCCTTTGGACATTGCCGG
GGGATACATGCTAGGCCACGAAACATCCAAGGTCAATCGAGAAAAACGTGACGCGTGGTTTCAGGAACAGGCCGCGATAG
AGATTCGCAATCGCAAGGAGGAGCAGCGAAGGGCCGCCGAAAGGGAGGCAGCGCGTAAGCTGGCCTTGCGGGAGAAGGAG
GTATTGCGAGAAGCAGCTCGCGAGGCAAAGAAACAGCAGAAGTTGGACAGCCAGGGCGGGATGTCGACACTCAGGGGATG
GTTCACGTCGAAGAAAGGTCCTGGAAGGACGCGGCTGTCTCGCAAGATGTCTATGGACCAACACGAAGAGCCATCGGAAA
CAGGAGCAGGTGGAGAAGGATGCGAGGCGGAGACAGACTCCATTATGACTGAGTCCGAGATGGCGAACGAGTCGGGTCTG
GAGAACCGTGTGGCTCGCAAGGGCAAAAAACCACTCACAAAGGAGGAAGCCTGGGAGCTTTACTCGATCCGACCGCCTCT
CAAACGGCACTCCAAGAAAGATTTAACGTCGAAAACCGATCGACTTGCATTGTCTCCTGAAATTCAGGAGGGAGGCAAGG
AAAGCACGGCGATTTTGGCGCTGCGGCAGCTGGGGCCGATATCACCACCGCCGAGTGCACCACTTCCTCCTCTTCCAGCA
TCTGCCAAATGGAACCAGGAACCATTGACGGACTCTGCGCTGATTCAAGTGGCGCAGGAGACAGCTGCTCACCAAACTAC
CTCATTGGACTGTCCCGTGGAGACCAGCCTTACAAGACCCGATACTCCGCAGTATTCAAAGATGTCCGAGACAGCTGCTT
CGTCGCCGGAGTCGCGTGTAGCAGGAGGGGTACAACGAGTATCCCACACCGCGACCGAGCGTTTTCAGCAGACACAACAG
CATTGACAATAGCACTGACAGCAGCCAGGAGAGGATCGGAGATCAAGATACAAATACGACACAAATGCCAAGAACGACAA
GGACATTCCGATATATGGAAAGCATGCAGATTGCATTTCGGAAGAGCCCATCTACACGGAGACAGAAAAATGTAGGACAT
CGACGAGTAGAGTAACGTAGGCAGACCATGTACGAACTATTGTGGCTGAATCGACAAACAGGATGCGGGATCCAAGCTTC
GACTTGGATGGAAGCGTGCATGTTTCGCGATTTTCGATGGGACCTTTACCTGTAAGGACTCGAAGCTATGTGCAGATTTC
GACCTAATAACGGGAGACATATCAGACATCGAAATCGGGTTTCTTGTACGGAGTAACTGTTTATATAATATGGAATGGAA
GCAATGAAAGATGTCGCAAAAGTGGGTCTGCTTGAGCAGGTTGTGAAACGGCGCGTGGAATCGCGTTTGCTCGACACGTG
ATCGCATTTCAATTACATTTTATTTTTGCGACTTGCTTCGCTTCGCAGTCGCGCCCTCCCAATAACGCCGGCACCGAACA
GAAATAAAGGCCACGGTAGTGTTGTCTGACAGAGTACAGATGACTATGGGAACCGTTGAGAGTATGCCTGAGGGCGCTCG
TAAGAAGGTGGTGCGGCCAAAGCCGAAACAACGGCACATCAGCACCGCAGCTATGCCAAGGCAGGACAGTAACGAGAGCA
GCACCAGCGACGATGACACAGAAGACATGGGTGAGGACGCCGATACGGCCGTAAAGGCCGAGGACGAGGAGAACGAAGAC
GAAACAGACGAATCTTCTGCTTCTTCAGAAGCGGCACGGGAAGATGCCTCTGCATTTGTGAAATTGGAGGCATCAGAGAG
CGATGGCGAGGGCGAGGACGAGGAGGATGAGGGAGAGGAAGACGAGGACAAGGACAAGGATGAAGAGGAGGATAATGAGG
AAGAAGACGGGGAAGATACCGAAAGAAGTGCCGTTAAAACGGAGGAACCTGAGAGCACTAGCGAAGAAGGAACAGGAACT
TCTACTTCTGCGTCTATTTCCGAAGCAGTTGTGGATGCGGTGGAGAGTGATGAGGAAGACGGAGCCGGTGAGTTATCCTC
TGGGGAAGATATTCCACTGCCGCGCAGACGGCTCTTCTCGTCATTGGGTACGAAAACCAAGCCAACGCCCGCACAAAACG
ACAGCCTGGCCAGGCATGCAGCCCAACATGAGTTGCAGCGGGATGCGGCAGTTGAGGATGTGGCGATGCACGACGCTGAG
CCGGCCGAAGACCCGCCACGAGACGACAGCGGCGCCGGCGCGAAAGAGGTGTCCGACGAGACAGCGGCAGATACGTATAG
CAGCTCCGACGATAGCATGGAGGATATTCCAGACGTGCTGCCGGAAGGCACCGCGGTCGATCATGCCGGGGACTACGAAT
GGCCGGCCGACAGCGATGCGCAGAGCCCAGACGCCGAATCGGACCACCGGACGGCAACCGTTGCAGTGACGAACTCGAAG
CGACAACCGGTGGTCAAGAGCGCCAAGAAGGGCCGTAAGCAGGTCCCGAAGCCGAGTATCCTGGAGCGAAATGGCGAAGA
AGACATCGAAGTCCCAGGCACGCAAACCTCGTCGATACCCAGCACACAGCCCCACGAGGCAGGCTTGATCGAGAATACGG
TCAAATCACCGAAGCTGGCGAGGATGAGAAAAGTAGGGAAAGAAACAGAAGCAGAGCCAGCGGAAGAGCCAGCAGAAGAC
TCAGCAGTACCAGAACCAGAACCAGCAGACGCAGAGCCAACAGAAGAGCCAACAGAAGAGCCTGCAGAAGAGCCGGCAGA
ATCAGCAGAAGAGCCATCAGAAAAGCCAGCAGAGTCAGCAGAAGAAGAAGCAACTGCAGTCAAGCCGACAAAAAACACGC
CGTCGACACCAGCCGGACCGGTTGCAAAGACTGCAGCCAAGAAGGTGCAGCGGACACCGGCATTACAGCAGGCGAAGACG
CCAGGCTCATCCGGCGTATTCTCGGCGGAGAACTTGCGACATCTGGAGGAAGTGGCAGCGGGAATGATCGACGAGCGATC
CCTGACGCAGCACGAGTTTAACGACATGGTGCAAGAGCCGGCGGCTCAGCACAAGGAGCTGTGGAATGCGATGCAGGAGG
CGTGCCCCAACCAGGCGCGGAAGAATGTGATGTTGCGGTGCCGGCGCATGTTCCATAACTACAAGGAAATGTACCGGTGG
ACGGCCGAGGAGGACGAGGAGCTGGGAGAGATGGTGGAGAAGCACGGGCACAAGTGGGCAGTGATTTCGGGGCTGCTGAA
CCGACACCGAGAGGACGTGCGCAAGCGATGGGAGGAGCGGGTGGTCTGCATGCAGGACGGACGGCTGTTCAACTGGAAGT
TTGAGGAGGAGAAGAAACTGGCGGGGATTGTGGGAGACATGCTGCGGACGATCCAACAATCACGCGGACAGGACGTGTTG
GAGGTCAACGCAGAAGCGGTGGCGGACCTTTCGTGGACGCAGGTGAGCGAGCGGATGGGACACACACGAACGGCACGGCA
GTGTCGGGTGAAGTGGAACGACGTGCAGGCGGCATACCATTTCAACGATAGGGGCGAGTTGATTGGGCCGCCGGCACCAG
CAGAGCCGACGCCATCGCAGAAGCGAGCGGCGACGATTGAGGCGATGGGGAAGAGCAAGTTGGACGCAGAGAGAGGCAAC
GGCAGCGGCCACGGCAGCAGAAAAGGCAGAGACGACCAGAAGGACGAGCAATGGCCGGTGCTGTTTGCGGGCGACGGATA
CGAGAATGGCGAACAAGTGCCGGAGACGGCGCGCAAGATCTCGGACAGGGTGCGACGACAGCTGCGACGGATGAGTGCGG
AAGACAAATACCGACTGATCAAGTCGATCCGGCATTCGAATGTTCTCAGTGAGCGCAAGATCCCGTGGACGCGGTTGGTG
GACGAGACATTCCGCAACCGGTGGCGACGACCGACGCGCGAGCTGGTCTGGAGCCGACTGAAGCGGACAGTGCCTGACTA
CGAGAAGAAGTCGGTGCAGGCGATTGCGAAGTACCTAGTGGACCAGTATGACCAGCATCAAAAGCTGGGCGATGCGTGGG
ACTACGACTTCGACAGCATTGGCGACAAGGACTTGACTGTTGGTGGAGGAGACGGGAAGGAGAAAGAGGAAGGAGAGGAT
AAGGAAGAGGAGGGACAGGAAGTGGGAGAAGAGGAGAGAGAGGAGAAAGAGGAGGAGAAAGAGGGGGAGAAGGAAGAAGA
GGAAAGCAGAGCGGGGCCGACTGCTATACAACGCGCTCGGAAGCGACCTCGAGCGACAAGAGAATCGGCAGCAGGACCGC
CACGATTTGGCCGTGCAAACAGCAAACGAGGAGCTGTTTACAGGGCGTATAAGAGCAATCGGCTGGTACTGGAAGAGGAC
GTGGAGGATGATGAGGAAGGGGAGACAGAAGGCGTTCACGACGTGTCGGAACAGGCAGAGCTGTCAGCAACGCTGTCTGG
ACGCCGGCAACACAGCAGCGTGCGAGAAAACGATGTGGACGTGCCGGAATCAGAAGGAGAGACAACGAGGCGGATCCGAA
AGAGAAGAGCAGCAGCCGATCCGTACTTCTTTGACGAAGACGGCGATGGAGGGCTGGCAGCAGACAAGGGCGAGGCAGAA
GCGACGGCAGAGGACGAGGTCGGAGAGGCAGACGCAGAGAAGGCGGAGCAAGGAGAAGAAAGCGAGGATGTCGACAAGGA
GGCAGAAGGTGAAAGCAGCCAGAAGAGCAAAGGGCGCCGAGGGAGCATCGACCTGGGCGTGGAGACGGAGCTCCCGGCGC
TTGTATGGCGGCCATTAGCATCAGGGTCGACATCGCAGGACAGTCTGGGCGGATCACAGCCAACGCCGGACAGGTCGAGC
AAAGCGGCAAGACTGGAGCTGGGCCGTCTGAGCGGATCACAACCAACGCCGAGAAAGTCGCAATCACAGCAGTCTAAGCG
GAGGCGACCGGCAGACCGGCTTGTCGAGGACGAGAGGGTGTCGGCATCGGCGAAGAAGCAGCGGACAAAGGTTTGATAGT
TGTGGCGGCGATACGGGCTGGCAGCGACAAGCCGCAATACTCACGATCGATCATGGATGTAGATGATGCTTCTAGTTGAA
AGCAAAATTGATGTATTGTTCAAAGCTGCACGTGCAAGACGCTGTTGTAATAAGCGGAAGGTGCAGAGCGTTGTGCCTTC
CGGCATCTTTTCCTTCGGACCTCAGTAGCGTGGCGCTGGTGCTAAAGACGCTAGGCAGAAGACGACTAGCGGTCTTTCGA
CGTCATGTGCTCCACCAAGTCCCCTCTTTTCTCTTCTCTCGGTCCACCGAAAGGGGAACGACAAGCGATAAGTAACGACG
ACAGCCCAGCGCCATACAGCTCTTCTGACGCGGCTGACAAGGACCAAGCGAGAGAAAAGACTGTGCGACGGAAAAGACGA
CATTACTCTTGCAGTTTACAAGACTTTATTCGACCGACCATCGATGCGTCTGCTCTCCTGCCAGCAAACGAACAAGCAGT
CGACGCGGCATCGAAGGAGCAACAAACAGAGCGACGACGATACGACGACAGCGTGCCTGTGCATCCGAGCGGCAGCGCCA
TGTCCCACACGCAGGCAGCAGCGGCGGCAGTGCAGCCAACGCTGATCAACATACCGCAGCCGCAGTCGAATCCGGACACG
CCGTCAGAGATGCCGTGAGTGAGGGCGAGCGAGAGCGAGAAGGCGAAAAAACGAGAAAGAGTCTTTACTGATACATGTTC
GCAGCGGCACGCCAACGAGCACGACGACATCGCTGTCTGCACTGTCGACGACGGCAATCAAGGATGGTCAGCGCGGCGGC
GGGATCAATAACGGTAGCGGCAGCCACGGCGGGCCTCGAGGCCATCAGTACCACTCATCGGCCAACAGCCTGGAAGCGGA
GCGAGCGGACCGGATTTCGCGTCTGACGGGCCTGTCGACGGTGTCGACGCTACGGGCAACGCGCGGCCAAGGAAGCCGTA
TGGGCAGTGCCGGACGCGGTGGAGCGCCACTGGCGACGCCTCCAGGCTCAGCGTCTTCGCTGTCGGGTGGGCCAGGGTTT
GCGCTCTCGGCCGTGCCGGGACCGTTGACACCGGCCTTTTTCGATGCCCACGGCCAGCCGGTGGCGATTACGAAGATGAG
CACAGTCGGCACAGCCAGTGCGACGGCCAGCCGGACAAACAGCGTCATGAGCGGCCACACGCTGGGAACGGTGGATGGTG
ACGACGACGAGGAGGATGATCTGATGCTGATGGACGAGGACGACCGGATGAGCAGCGGCTTGGGCGACGAAGGCGACGAC
GACGACCCGGTGGACGACGACGACGACGGCTCGGCCAGCCTGGTGGGCTTTGGCGAGGGCGCCGGCAGCACGATCTCGGG
GCCGATCTATCAGCGTCATCACAATCTCGGATTCGGATTGGGACGGCATGCTGGCTCGTCGGCCGGCGCCATGGCTGCGT
CGACCATCTGGGCCGAGCAGCAGCGCCAGCAGCGACGGCTGCAGCAGATCCAGGACGATGTGTTTGTCGATCGGGCCATG
GCCTCGTCGCCTACATCTGCTGCTACCGGTCCGCTGCCTTTTGCCTCTTCTTCTTCCGTCATCCAGGCCCATCCCAGCGC
CCTGCGCGAGACCCAGCGACCGCGCTCCCATCAGCAACAGCAGCAACAGCAGCAACAGCAGCAACAGGGCCTCACACGTG
AGCGCGTCGCCGCTGAACAGATTCTGCGCAGCCTTGGTCGCCTCGACGGCCACGAGCGTTCGGTCTCGGCCTCGTCCTCA
ACCGGCCAGGATCACTACCAGGCCTACCAGCTGCAGCAGCAACAGCAACAACAACAGCTGCAGCAGCCAGACCCAGCCCA
TTACCACTACAGCCACCGGCACGCCAACAGTGGCAGCACGGCCAGCAGTCTGGCCAGCCCCAGCCACAGGATCAGCCGGC
GATCCGGTCGGTTCATCTCTGACGAGAGACGGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62