GenePrediction:GLEAN_8233 Details

Name: GLEAN_8233
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:191428..189928 (- strand)
Length: 1501
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:191428..191203 (- strand)
Length: 226
Type: CDS
Source: GLEAN
Position: GCSC_113:191118..191000 (- strand)
Length: 119
Type: CDS
Source: GLEAN
Position: GCSC_113:190911..189928 (- strand)
Length: 984
>GLEAN_8233 class=GenePrediction position=GCSC_113:191428..189928 (- strand)
ATGCGTGCATCCTCCGTACGGACGCCGCCGGCACTGCCGGGCTGTCTGCGGGTGCAGTCGACGCCACGATATGTCTGCCG
GCAATGCATCATCACGACGACGACATCACCCGTTATCGGCACCCGGGGCATCAAGATCAGCTCTGCGCCGGCCACGGAGT
TTCCGCGCCAAACAGGCGGCGACGCATTCGGATCGACAGCTGCGGGCAGCGTGCGGGATGAATCAGGTGTGTGAGGAACC
GGCCAGGCTGAGGTGGAGACGGTAGTTGGCATACGGGTCGATACGGTTCCGAATCGCTGACAGAAACCAGACGCCCGCTT
CGAGGTCCTCGGCTCGCCCTATTCGCTCCTCTCCGTCACCCTCTCAGCCTCACAGAAGCTCTACACGCGGAGGGGCACGC
TTGTTTCCGTCGCCGGCAAGCTGGAGAATGTAGGCAGACAGCCATGACAGTCTTGACGTTTGCGAAAGTCTCCTCCACCT
CTTCTAACCCACCCCACCTTCTCCTCTCCTTCTGCAGGCCCAATCCACACTCTCGATCTTGGCTCCCGTCCGCCGGGGTC
TCCTTGGTGTCCCCTTTCTGTACCAGCGCATCACATCGCCGACTCCCTTGACCCTGCTGATCGGCACCAAGGCTGCCTCC
ACCACGCTCTTCACCCTGCACCTCGACGGCACCACCGACTGGGTCGTTGCGCAACGCGACGCCCTGCTCGCCTGGACCGG
CCACACACTGACCGTCACGCCTCAGCGCCAGACCTACGGTGGCACCGGCCTCGGCCTCGGCCTGGCCAACTGGGGCAGCT
CTTTCCTGACCGGTCGCGGTCTCGTCGCCCTGTCGGCACCCGGATACATCTACCCCGTCACGCTGGCCGCCGGTGAGGAG
CTGGCTGTACACCCCAGCCACGTCGTGGCCTACGCCGTCAACCGGAACGCCCCTCGGCCCTTCCGGCTGCGTGAGGGCGG
CGCTGCTGCCGCCACCAAGTCGGCCACCGCGGCTGTTGCGAATGCAGCTAGCACCACTGCTGCTGGTGTGGGCGCAGCTA
CTGCTCGCCTGGCCGGCCGGCTCCACCTGCAGACACCGGCCATCCCGGCCGTACCCCAGTCTGTGTCCGGCTTCTGGAAG
GCAGCGCGGGAGACGGCCACGTACAAGCTGGCCGCACGCGCCCTCTTCACTGCCCGCACTCTTCTGCGGCAGACCATCTG
GGGCGATCGTCTGTTCGTGCATGTTCGGGGCCCCACAACGCTGCTGCTGTCGAGCCGCGGCGTGCGCATATCCGATGTGC
TGACACGCAACGATGTCAACGAAATTGCTGACACCGAGGCCGGTGTCGTGCCCGCTGCCATTGAGAGGGTGACGCATCTG
GCGGACAAGACAGGAACGGACAGCGAGAAGGCTGCACCGTCCGCCTCGTCCGAGGCCGTGGCTCTCCATGTGGCTACCGT
GCGCCAGGACGGCAAGGTCGAGTTCTCCGACGCCAAGGACCTCAAGGAGTTTGTGAGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62