GenePrediction:GLEAN_8234 Details

Name: GLEAN_8234
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:188969..185068 (- strand)
Length: 3902
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:188969..188748 (- strand)
Length: 222
Type: CDS
Source: GLEAN
Position: GCSC_113:188405..188089 (- strand)
Length: 317
Type: CDS
Source: GLEAN
Position: GCSC_113:188024..187985 (- strand)
Length: 40
Type: CDS
Source: GLEAN
Position: GCSC_113:187901..187469 (- strand)
Length: 433
Type: CDS
Source: GLEAN
Position: GCSC_113:187415..187243 (- strand)
Length: 173
Type: CDS
Source: GLEAN
Position: GCSC_113:187171..187026 (- strand)
Length: 146
Type: CDS
Source: GLEAN
Position: GCSC_113:186981..186540 (- strand)
Length: 442
Type: CDS
Source: GLEAN
Position: GCSC_113:186429..186016 (- strand)
Length: 414
Type: CDS
Source: GLEAN
Position: GCSC_113:185950..185495 (- strand)
Length: 456
Type: CDS
Source: GLEAN
Position: GCSC_113:185421..185068 (- strand)
Length: 354
>GLEAN_8234 class=GenePrediction position=GCSC_113:188969..185068 (- strand)
ATGTCCGTGTTCTCAGCCGATGAGGATGTTATAGCCCGGCCGTTGCGGAGCAGCACGTGGTCACCAGAAAGCACCACCCA
GCCACGTGCAAATGCGTCTGAACAGCGGCCTCCGTCCCCGTTGTTTAGGCCCGGTCCTCGCTCGCCTTCACAGCGGCAGC
CGGGCAACCTCCACAAGCAGAAGCTTACCTCAAGTGACAGCAGCAGCAGACGAGGCTTACGGGTAAAAATTATCTTTCCA
TCACGATCACGATCACGATCACGGTCACAGTCACGGTCACGGTCACGGTCACCGGAACGTATCAGAAGGACCCGGTCCCG
AGACGACATTTCGGTGACTACGCCATGGATGGATGCAACCAACCGGCCTGACAGGCGCAGACGCGTGCGCGTAATGTCCC
CAACGTCTTCAGATGAAGAACGCCAGCCTAGGAGAGCGTATAATGAGGACGGTGACAATCATGAAGACATTGACGATGCC
AACGATGACGATGACGATGACGATGACGATGAACTACATTACCGTGATCGGGGCGGACGAGAATTTTACACGAATACCAA
TGAGCCTGCGGCCGTATACTCGTTCAAGCCGTCGCAGTTGTGGAACACAACGTCGTCGTCGCAGCTGAGCCTATTGGACC
TTGACGAAGGCGACGACGGTGGCGGTGGTGACAAAGAAGAGAACGTCAGCGGTGGTGCAGTAAACGGATCTGAGAACAAA
AACGACGCAAGCGGAGGCGCCAATTTGCGCGAAAATCAGAAGTTGCTGAATGTATTTGAATCGCAGTACAGGGGCGATTA
TATCCTGGGAGGGACGCACAAGGCCAAGCTCTCGGCGGTCCTCAGTAGGCGGCCGAAGCACCAGCCTCTGTTCCGATGGC
TGTGAGATCCCTGTCCACAACAGAAACCAATATCAATACCGTTGTGGCTAAAACTAACTTTTCAGGCACTGTACGCGGAA
TCCGATGGACTTTGAAGATTTTTCGGTAGGCTTTTCTGCCGATCTTATTCTCGAATTGCCAAAAGCATGGCAGAGGCCCT
TCTGACAAGACAGCGAAAATTGCTGCAGGCGAGTGGCCTGACGACGGCCGAGAAAACCGGTATTCGCGAGCTTCTTCCAC
GGGTTCAGCGTAGATACGTAAAGACAGTGCAGACAGCCAGCGGTATGCGGGTTCAATACATGACACCGAGCATAATCTAT
CATCCACTGTCACACGAGGCCCCGGGTAAGAAGGCCAGCACTCAAAAGAGGCGTACTCTGACGTGGGTCTGTCTGCCATA
TCTTTCCCTAGAGAAGTACTCAGGGCTGCAGAGCGGCGGTGATGGCAGTCTTCGCAGTGGAGTCATCCCACCGAGTTTTC
CGGTCGCGACACTGCTGCAGAATAAGAACACACGGACCGGTCAGGACCGTGACATGCGACAAGCCGTGTGCCAGAGCCCA
GTAACACCATCCGGGATGTGTTTCCATGTGCCACAGCTGTGGATTGTGATGGTGGACAATAGTAGGTGCTGGTGTGAAGT
ATGCTCTTACTTATCCAGACGCTGACCTGGGCAGCCTTTCTCTTCACCTATGGCCGCATGACGGATAAGGAGCTCCGAGG
CGATGGCATCAGTCTAGTGCTGCAGCCGATTTCGGACACCACACACACACAGCCTTTGAAGGTGATTGCAGTAACCTTTG
AAAAGGTGCTGTGGTCGATTCCCCTCGAAGAGTGCATTTCATGGCTGGTGCGTCAGGGCGTTTCAATTTTCTAAAATCCG
TTCCTCATGATGCCCGCTTACCAATGACTGACTTTCAGGACTTTGTCGGCCACTTTCGCGAGTTCTGGCCGAGCCGTGTA
CAGTTCTTCCGTCACGGCCGGGCCATCAATGCCGACGACTGGTCGCGAATATGGAACAAGGCCCGGCACATTGACGATAA
GATCACATTAGAGATGCGAATTGGGTGAGTCTATTTTGCCCGAGTCAATCGACAGCACTGACGTCTAGGCCTAAACCCGC
ACCGCCTCCGGTTGGCGTTCTGTTGCCACTGGGAGATACCCACGAGGCTCCAGCGAGGCCGTCCACATCTACAACTGAGG
ACAGACTTACAGCTACGAGCCAGGCAAAGTTAGCCGTCTTTACTTGTCTGGCTGGCGTGCTGTACCTCGAGAGCGGCACA
GTCAACCAAGATGTGCTAGACGACAGGCTGCGTGAGGTCGAAAATTACCTGCAGACAAAAATATGCTTCAGCGACCGGCG
TATTTACACGGCATGTCCGGTTATGACGCGTGAGACTGTGCGCGCGAAGCTTGCGGCCGAGGGCGCACAAGCAGCCCCAG
AGGGTCTACAGCGGACGGGCATCTCAGAGTATGAGATGCGACTCGACATTTTCAACGCTGCCGACGTGGTTTTCCAATTC
TTCTTTCCTCTAAATGTCGACGTGCCAACGGTGCGTAAGTATTGGGGGGCGCTAGAACAAATGATCCAGGTAGGATTTGT
ATTGTTTCTTTTTTGAACCAATTTCTATCCAAACACGCTGACATTGTGTTTGAACTGTAGGGCGGATCGGAAAATTTCAA
AGTTTTCGGACGAACTCTGCGTATAGTCCTGCGCAGGTTGAGCAGGAGAGTGCAAATGTTCCAGGAGTTGTTTGGCGGGA
CTGGCCTGCGTGAGCCGGTCCAGCTGGCCACGGTGCCCAACGAACTTGTCGATGCATGGATTGACCTACTGATGTTTCTT
GTTCTCCTGCCTGCGTATACGGGAAAGTGCAGTCAGCTGCTGGAACACTGCAATACACTGCTGAGTAGCGGCATGGCGGC
GGCCGTCCTGAAGCTGTCAGACCAGCCGCTACTGGCCCGAGTCGTCGTGCAGCCGATGGACTTGTTAGCGTTGCTAAGCA
TGCCCATTATGCAAGACGTGACCGGAGGCCTGCCTGATATCTGCGAGTGTTACTCGGCGGCGCTGGAGTCGATGGTGAGT
TTTGGCCAGCAAGTAGGAGGAGGCAATGTGATAGACGGGAATCTAAGCTGACCGCTTAGAAATCTGAGATTGCTTTGCAG
CGTCCTGATCGTTCGCGCGACTACCGCATCAGCCTGCTGGTCGAGGAGATCATGGCCGTGGAACGTGTCGTCACGGCTCA
AAGCACCATCTTCCAGATTCTATTTAGATATGGAACAGCAACCGATCATACGTCGAATGGTCACGAGACACTTTCAGAAA
TCTATGCTTGGGGCTACCAGCCTCGCGAGTTTAGCAGAGAGGCGAAATCATCTAATGGTGGTAGACGTAATCAATATTCT
CACATAAGAGAAACATACGCATACAACGGCGTGGCTACTGCTAAAGCAGATTCCCTGGCTGACGTCGGCAAACTGGCGGC
AACAGACCCATACGGCTACCGCAGACTACTGCTGCACGAGTGCCAGCGACTTCTGGATGACCGCTCTGAAGACTTTGACA
TGTTGCGCAACTGGGCGGCGTCCCTAGAGAAATCGGTGAGTTTTGGAGTTGTGTGACGGCTTTTTGTAGAAAGGTGTCTG
CCTCCGTGTTCATTGCGCTAATTTGCAGAACCAAAACAAAGTCGACACGACCAAGGACCGGCACGACAATGCCCTGTACG
CGTTCACGATTGTGACCGTCATCTTCCTGCCGCTGAGTGCTGTGGCCAGCGTCTTCGGCATGAACACCAACGATGTGCGC
AACATGGAGGTAAACCAGTGGGTGTACTGGGCTACGGCGCTGCCGGTGACCTTGGTCGTCGTGCTGCTTGGCCTGCTCTG
GACCGGCGAGTTGGGCAACCTGGTGCGCTGGATCCAATCGTTTGGAACGCCAGTGGTACCGGTGGGCTACCAGAAGCCGT
TGGGTAATGATTCGGAGGAGGATTTCCCGTCAGTGGTGGTGAGGAGATACAGTAGAGACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62