GenePrediction:GLEAN_8235 Details

Name: GLEAN_8235
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:181337..179678 (- strand)
Length: 1660
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:181337..181179 (- strand)
Length: 159
Type: CDS
Source: GLEAN
Position: GCSC_113:181141..179974 (- strand)
Length: 1168
Type: CDS
Source: GLEAN
Position: GCSC_113:179832..179678 (- strand)
Length: 155
>GLEAN_8235 class=GenePrediction position=GCSC_113:181337..179678 (- strand)
ATGACGGACGCACCGGCTATTGAGAACGGTTCAGCTTCAGCTTCAGCGCCCGAGATCCACGTTGCCGGCTCTGCAGCAGA
TGCCAGGACCAGACAGTCAGCCTCTGACAAAGAGTCAAGCGCCGCTTTTCCGGTACTCACTCACACTCTGCGAGTTTCGG
TCCGTTTTTTGCCATTCATCTAGCTGACATACCAAGGAGAACGTCACGGGCACAACAAGCTTGACTGACGAGCAAGCCGT
GAGCCGCGATCTGTCACCAAGTGGCGAGACGATCTCTGACAGCAATTCTGTTGTGATGGCGGGTGCCGCCGTGCAATCGG
CAATGCTGACAGCAGCTGCAGCGGCCAAGGCGTCTGCATTATCACCACCGCCGCCCGCGACAAATGGCCAGGCTACGGTG
ACGCCTGCCACGGCAGAAGCCAACGGACTCGGGCGACGCATTAGTCTGGTCAACGGCACTGGCCGTGGCCAGGCCAACGG
AGCGACCAGTCGTGGTGGGCGGTATCGCGAGACGCCGCGAAGCAGCTTGGGTGCAGGCGGAGGTTATGCGGCGGCTGGCA
TCGACCTGGACGCTATTAGTTACCGGCAGCTGAACGAGGATGTGGACGCGTACGCGGTGGACCTCGACTTTTGCGACTCG
CAGCTGGCGCAGCCCGACCTGACGCCACAGGAGATGCGCACACTGCAGCTGCGGCGACTTGACCTGGGCCATCAGATTCG
CTTCAGCCAGCACCGCCGCGAGATGTTGGAGGCGCAGCGGCTGCTCAAGGGCGGGCGACCGCTGGGGCGCATCGTCCACG
GCAGTGCAGGAGGGCGTGACAGCAGCGTCACGCTGGCGTCGCGGTCAAAGACGCTGCAGGGGCCGGCAGGGCCGATGACA
AAGCGGTCGATGTCGGTGACGGCTCTGCCGGGCGACCCGGCAGCCAAGCGGGTGCGCGCCGTGTCCGAGGCCAGCGGACA
GGACACAATCAGCGTGCACAGCAGCAATGGTTGTGGCAGCGACAGCAACGTGGACGGCAGCATGGTCGGCAGCCGGCGCT
GTAGCCTGGATCCGGATGCGACGGCAGCAGCGGCTGATGTGACGATGCTATCGACGATGACGGCAATGACGTCGGCGACA
AATGGGACGGACGAGGCGGATGAGCGAGACGCGACATATTCGCTGCAGCGGCTGGGCTTTTGGAAATGCCGGCTCTGCAC
GTCGGAAAAGTATCTGATGGCAGGCGCCGGACGGCAGCCGAGCGCGCCGTCCAAGTGGCCGCTCAAGGACATGGGCAAGC
TCATGTCGCACTACTTTGACATGCACACGGAGCACGAGCCGGACGAGCGGTGTGCTGAGCTGGGCGATGCGCTGGACCGG
AACCGTGAGTTTTTTTTTTTTTTTGTGGCCGTTATCTTGTTCCTTTCTTGCCCTTCTTCGCTCGTCCTTCCGCTTGTTTT
TTCGCTCGTCTTCCAAATTCTCTTCTCTCGTCTTCTTCCCTCTTCCCCCGCTGACATTCCAACAGGCGGTCCGTTCGAGT
ATTGGCTGCGCAAGTCTCGGGCCCAACGCATCCCAGACCGGTCAATCATCGACCAGGTAGTGCAGGAGCTGCAGGACGGA
CGCGTGCCTAAGACGCTGCGAGATCTCTGCCGCGCAGCAGCGGCGTTTCCGGGGGCCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62