GenePrediction:GLEAN_8236 Details

Name: GLEAN_8236
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:178689..176519 (- strand)
Length: 2171
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:178689..178643 (- strand)
Length: 47
Type: CDS
Source: GLEAN
Position: GCSC_113:178509..177535 (- strand)
Length: 975
Type: CDS
Source: GLEAN
Position: GCSC_113:177472..177331 (- strand)
Length: 142
Type: CDS
Source: GLEAN
Position: GCSC_113:177268..176519 (- strand)
Length: 750
>GLEAN_8236 class=GenePrediction position=GCSC_113:178689..176519 (- strand)
ATGGCGACAGAGCACCATGCGCGAACACGAGCTGCAGTGGTCCTCCAGTAAGCCGTGGGTGCTGATATAAGAACCAGACC
GTCTCGGTGCCTTCTCCCGTTGAGCTCTCTCTTCCACTCACTCCTCTCACCTTTTCCGTCTCTCCCTCCCCTCCTCTCTC
CCCTCTCCAATGGCTTGCAGTACCCTCCGCGGCTCTATGGCCACCCTGGCCCTGGCCGTCTCGTCGCTGCTGCTCTTGCC
GGCCGCCGAAGCGGCGGTGATCAGCAGCATCGACACCGTGCCCAAAGGCTGGTCGGTGGCTCCAGCGGCCAAGATCAACG
CCCGGACTTCGTCGGCGCAGGTCTTCACCATTGCCTTGGCGCTGCAGAACATCGATCAGCTCGAGTCGCACTTGTTGTCG
GTCTCGTCGCCGAACAGCGCCAGCTACGGTGCCCACGAAGATGTGGAAGGGATCACGGCCAAGTATGGACCCTCGGACGA
GGCCGTGCAGGTCGTGACAGCTTGGCTCAAGAGCAGCAGCGCCGTCCAGACGTTCTCGGTGCGCGACGGTTTTGTCGACG
TGGCCGCGACCGTTGACGGCGCCAACACCCTGTTCAACGCCTCGTACGACTTCTACACCCACGAGGCCAATGCGGCCACC
ACGAAGCTGCGCACGCTGTCGTACTCCGTGCCCGACCACGTGGCTGCCCATGTCGCCCTTGTCGACCCCGGCAACTACTT
TGGCAAGACCGCGGCGTTTGCACCGCGCCGTGGTGCCCCCGCCCCCGTTCCGGCCTCTAAGACGGCTAGGTCCCCGAGCC
TGGTCAAGGCTAGGGGCACGTCCACTACCATCGATGCCGCCTGCTCGACTTCCATCACACCTGCCTGCCTCAAGCAGCTC
TACAACGTCGGCAACTACACGCCCGACGCCAGCTCCGGCTCGCGTGTCGGCTTCGGCAGCTTCCTCAACCAGTCGGCCCT
TTACGCAGACGTGTTCACGTACGAGGAGCGGAACGGCATTGCGGCACAGAACTTTACCGTCGAGCTCATCGCCAACGCCA
CCAACGACCAGGACAAGTGGACCGCATCCGTCGATGAGGCCAACCTGGATGTCCAGAACATCATCGGCGTCTCGCACCCG
CTGCCCGTCATCGAATACATCACTGGCGGCTCTCCGTACGTTTTATCTCTGTGTGTGTCGAAATGCGTGATCGGCCTGCT
AACGGTTCGCTCTCCAGACCGTTTGTCGCCGACATCGACCTGCCCTCGGCTGCAGAAAACCAGAACGAGCCGTACCTGCC
GTACCTCAGCTACCTGCTGGCCAAGTCCAACAGCGAGCTGCCCCAGGCAATTTCCAACTCGTATGGTGACGAGGAGGATG
TATGTTTTCCCTTTCCCTTCTCTCTTTCTCTCTGTCTGCTGCTCCGTGCTGACTCATCCAGTCTGTCCCGTACAACTACG
CCAATTACACCTGCAACCTTATCGGCATGCTGGGTCTGCGCGGAATCACCGTGCTGCACTCGTCTGGCGACATGGGTGTC
GGTGCTGGCTGCCTGGCCCCCGACAACACCACGGTCGAGTTCAACCCCATCTACCCGGCCACGTGCCCGTACGTGACGGC
TGTCGGCGGCACCGTCAACGTCTCGCCAGAGATCGCCTGGAAGGGCTCTTCCGGCGGCTTCAGCAAGTACTTCCCGCGGC
CGTCCTACCAGGACAAGGCTGTCAGCGAGTACCTCTCCGATCACGTGAACGCGAGCACGGTCAAGTACTATGCCCCGTAC
ACCAACTTCAGTGGCCGTGGCTTCCCCGACGTGTCTGCTCACAGCGTTTCGCCCGCCTACGAGATCATCTACTTCGACCA
GCCAGGCCCGTCGGGCGGCACCAGCGCTGCGGCGCCTGTTTGGGCTGGCATTGTCGGCCTGCTGAACGACGCCCGCCTGC
GTAGCGGCAAGTCCACTCTGGGCTGGCTCAACCCGCTGATCTACACCTATGGACCTTCGGTTCTCAACGACATCACGGAC
GGCTATTCCGTTGGCTGCAACGGTGTCAACTACCAGACCGACCAGTACGAGCCGGCTGGCGCTGGCATCGTGCCGGGCGC
TCACTGGAACGCGACCGTTGGCTGGGACCCTGTCACCGGCTACGGCACGCCTAACTTCGAGGAGCTGAAGAAGGTGGTGC
TCGGGCTTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62