GenePrediction:GLEAN_8237 Details

Name: GLEAN_8237
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:167570..165824 (- strand)
Length: 1747
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:167570..167414 (- strand)
Length: 157
Type: CDS
Source: GLEAN
Position: GCSC_113:167350..166470 (- strand)
Length: 881
Type: CDS
Source: GLEAN
Position: GCSC_113:166407..166232 (- strand)
Length: 176
Type: CDS
Source: GLEAN
Position: GCSC_113:165986..165824 (- strand)
Length: 163
>GLEAN_8237 class=GenePrediction position=GCSC_113:167570..165824 (- strand)
ATGGCCGACCTTGCGAAGAAGAAGTGGTGGCAGATCCGGTGGTTCTCAGAGGACGACACGGCCGAGGACCGCAAGTTCAT
CATGAAGCTGGACCTGATCATCGTGCCGTATCTGGTGGTGTCATACTGGGTCAAGAATCTGGACCAGAACAACCTGAGTG
AGCAGCGAGCCGACAGACTTGGGACGGGCTGAGACGGACCAGTTGCTGACCGGCCTGCAGACAATGCCTATGTGTCGGGC
ATGAAGGAAGACCTGGGCTTCTACGGCAACCAGCTGATCCAGCTGCAGACGATCTACATTGTCGGGGCTGTTCTCGGCCA
GCTGCCCTTTCTGTTTGTCTTTACGTATGTGCCTATGCACTACCTGTTGCCCGGATTGGACGTTTTTTGGGGCATTTTCA
CGTTGCTGCAGTACCGTGCGGCCGGCTACTCGGAGATGATGGCGTACCGCTTCATGATCGGCTGGTTCGAGGCTGCCTAC
TTCCCGGCCGTGCACTACGTCCTCGGCTCGTGGTACCGCCGCTACGAAATCAGCCGTCGCGGTGGCATCTGGTACATCGG
CCTGCCCATCGGCACATTGACGGCAGGCCTCGTCCAGGCCGCAGCCACCCAGCGGCTCGACGGCGTCCACGGCCTCGCCG
GCTGGCGCTGGATGTACATTATCTGTGCCATTATAACGATTCCTGTCGGTATCGCCGGCTTCTTCCTCATCCCCGGTACC
ATCGACCAGCCAAACCGGATGCTGCTCTCCCAGCACGACGTCGACGTAGCCCGACGCCGGCTTCAGCACCACGGCCACGC
CGTTCAGGGAAAGCTGAAACTGCATCACATCCGCCAGATCTTCACGACAAAGTCCTTCTACCTCGTCGTCCTCGTCGACG
TGCTCTTCTGGAACCATAGCGCCAACACCGGCGGCTTTCTGCTCTGGCTCAAGTCGCTCAAGAAGTATAGCTCCGAGGAG
GTCAACCAGCTCGGCACCCTTCCGTCTGCGCTCGGCATCTTCTACACCCTCTTCACCAACTTCTCTTCCGACTTGCTCTG
GGGTCCGCGCTGGGGCATCACCTTTGCCGCCACCGCCAATTCCATCGCCATGCTGATCCTGGTGAGCTCTCCTGTCTTCT
CTATGTACATGCATGCACATGCCGCCTTAACTGACACGCCCAGACTATCTGGAATGTCCCCATTGGCGCCAAGTGGTGGG
CCTTCTGCAGCACATCCTGGTCGTACTCGCTCTCCAGCTCGCTCTACGGCTGGGTCAACAACATCCTGCGTGACTCGCCC
GAGACACGGTCCTTCACCCTCGTCTTCATCAACATCATCGCCCAGTCGACGACGGCATGGTGAGTATCAGAGTTGCCCTG
AGTAGCATTCCTCGCTGATTCCTATAGGACTGGAATCTTGGCATATCCCACTGTTGAGGCGCCCCGCTTTCATAAGGGCT
ATCCCTTCAGCTTGTCGTGTAGCCTTGGTCTCATCGTTTTCACTCAGGTGCTCTATTTCGTTCTCAGACATAAAGAGTAC
GTTTTTCTTGTCTACCACAGCTATGGAGATAGTTATACTAACGTTGCTCACCCCTCTTTAGAAGGAAGAAACTACAGTTT
ATAGACGTTATCGGAGAGGAACACTCTGGCACTGAGGCCATAGCCCATAGCGACGACGAAGCCTTTCCTGTCGTTACAAA
GCAGGCTGTCATCACAGAACAGGCATTACCGAATCTTGGAGCAGCACTCAGAACTGAGATGGTCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62