GenePrediction:GLEAN_8239 Details

Name: GLEAN_8239
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:163042..161466 (- strand)
Length: 1577
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:163042..163006 (- strand)
Length: 37
Type: CDS
Source: GLEAN
Position: GCSC_113:162930..162030 (- strand)
Length: 901
Type: CDS
Source: GLEAN
Position: GCSC_113:161907..161466 (- strand)
Length: 442
>GLEAN_8239 class=GenePrediction position=GCSC_113:163042..161466 (- strand)
ATGGCGAAAGATAAGCTTTGTCTAGCACGGCTTCCACGTGAGTTGTACCTGGCCTCGGCTGTCTCTGCATCTACTCGGCG
CTCTTCAACCACTAAACCGGGCCCGGTTGCAGATGCGATGAATGACAGCAGCGACCCGCAGCGACGCCAAGACGAGCTGG
CGGTGGTTCCTGGCAGCGTCATCTCCGACGGACATGGTGTCTTCCTAGACAAGGACACTGCCATCGCAGCCGAGGCCAGA
CAGGCATCTTTGCCGGTGTCGCCATCGCCCGTATCGCCGCCATCATCACAGTCCGCTCGATGGCCACACACGGCGAAGCG
GCTCTTTCTCCTGCTGCTCGATCAGTGGCTGCTCATCGGCATGGGTGTTGCCTGCGTTCTCGGCTACTTCTATCCCGACG
TGGCCAAGAGTGGCGGCACAATCCGATCGCAGTATAGCATCCTCTACGGCGCCGTGGCCTACATCTTCCTCATCTCTGGC
CTCAGCATCCCGCGCGAGAAGCTGATCGTCCATCTGACCAACTGGCAACTGCACGTCCTCGTCCAGGGCATGTCCTTTGT
CGTCGCGCCCGCCATCTTGACTGCCGTCCTGCGCATCATTGTCGCCGCCGACCATCGCCGCGTCATTGATCGCGCCGTTG
TCGCCGGCTACGTCCTGCTCGGCTGCCTTCCCACCACCATCTCGTCCAACTCTGTCATGACCCGTGCCGCCGGCGGCGAC
GAGGCCGCTGTGCTCGTCGAAGTCCTCGTCGCTAACCTCATCGGCCCCTTTGTTACCCCCGCCTGGACCATCGCCCTGCT
GCCGCGCTCGTCCGACTTTGACATCTGGCGCGGCCATGGCGCTGACCTGCGGCCCATGTATGTCCACGTCTTCAAGGAGA
TCGGCCTCAGCGTCCTTCTACCTCTCGTCGTCGGTCAGTCATTGCGTTGGGCCTGGCCGGCCGTTGTCGAGTCCACATTG
ACCCGCTTCTACCTCAAGAAACTGTCGACCGTCTGTTTGCTTTTGATTACGTGGTATGAGGTTTTCTGCTTCTTTTTCTC
TTCTCCCTTCTACTCCTTCCTTGGCTATTTTCTTCATCTTTATAGACTCTTCAACATTCCATCTTCTCCTCCCTCTTTCT
TACTTTTGCCACCAGGACCACCTTCTCGTCGTGCTTTGCCACAAACGCCTTTGAGCTGCTCAAGCCCGGATGTATCGCCT
TTATCCTGCTGTTCAACGTCGCCCTCTACCTGCTCTGGACAGCTATCGTCTTTGTTCTGGCACGGCCACCGTGGCGGCCT
TGGCCGTCGTCTCGCCTCGGCCGCGCTCTCTTCACAAAGGTCGAACCGCTCGAGACGATCGCCATCTGTTTCTGTGGGCC
GGCCAAGACGACCGCTCTTGGCATTCCCCTGCTCAACGCCATGTGGATCACCGTCGACCTGTTGCCGCGGTCGACTGCAT
CCATTCCGGTCCTCATGTTCACTACCGAGCAGATATTTGTCGCTCATTTCATGGTCTATGTCTTTCGCCGCTGGCTCGCC
CGCACGCCGAAGTTGGATGATGAGTTAGGACAGGAGACGACCCTGGAGGCTTCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62