GenePrediction:GLEAN_823 Details

Name: GLEAN_823
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:237592..238185 (+ strand)
Length: 594
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:237592..237953 (+ strand)
Length: 362
Type: CDS
Source: GLEAN
Position: GCSC_132:238023..238185 (+ strand)
Length: 163
>GLEAN_823 class=GenePrediction position=GCSC_132:237592..238185 (+ strand)
ATGTCCTCCATCACGCTCTACGATGTGGCTGTTCCCACGTTCACACGTGGCCTCAAGACGCTCGACCACATCCTGACGAA
GGCCGAGGAGTATGCCAAGGAGAAGGGCATCGACGCCGATGCCGAGTTTATTCAGGCCCGCCTCATCGAAGACCAGTTTC
CACTTCTCTTCCAGGTCCAGAACTCGACCCGGAATGTGAAGACCTACGTCGACCATCTGACCGGCAACATATCAGAGCCG
TTCACAAACAGCGAGAAGACGTTTGCCGAGCTGCATACGCGCATTAGTGCCACCCTGGAGCTACTGAAGACGGTCAAGCC
GGACGTCGCAAACGCACGGGGCGGGACCAACACGGCCGATTTGTAAGTACCAGCAGTCACTTTTCTGGCAGCATTCATCA
CATCCTAGAGACGAGCTAACGTCTCCTGCAGCACCGTCGGTGGCAAGGAAATCCAGTTGACGATAACGCAAGCTGTGATC
CAACAAGGAATCCCCAACTTTATCTTCCACGTCACCACTGCGTACTCTATTCTGCGGGCCAAGGGTGTGCCTGTCGGCAA
GTCGGACTACATCTCCAGCTTCATTTTCAACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62