GenePrediction:GLEAN_8240 Details

Name: GLEAN_8240
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:157028..156229 (- strand)
Length: 800
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:157028..156611 (- strand)
Length: 418
Type: CDS
Source: GLEAN
Position: GCSC_113:156552..156470 (- strand)
Length: 83
Type: CDS
Source: GLEAN
Position: GCSC_113:156408..156229 (- strand)
Length: 180
>GLEAN_8240 class=GenePrediction position=GCSC_113:157028..156229 (- strand)
ATGTTGACATTTACTACGCTCTCGACTTTGGCTCTTGCGGCTTTGACAGTCGCTGCGCCAGTCGAGTTAAAAACACGCAC
TACCTGTTACAGCGGTGTTTATGTCATTGGTGTTCGCGGCAGTGAAGAAGATGCGGGATTTGGCAGCACGGCTACCGTCG
TCAACGACGTGTTAGAAGCTATTCCGAGCTCTGGAAGCATTGCCCTGGATTATCCCGCTTCTGTCGTTGATCCGATCTAC
AGCAGCTCCGTGACTGACGGCATCAAAGCCCTGATCACCTTGGTTCAAGACTATGCCGATGCTTGTGAAGGCAAGATTGT
GCTGGTGGGCTTCAGCCAAGGAGGAAATGTCATTACCGATGCGCTTGCCGGTGGTGTCCTCAAGCCTACGCCGCTCACAG
CGAGCTACGTGGATCACAGTACGTTGCTGAAGGACCGTACCTTACATTACGGCGAGGTATCTAACATCGTCTCTAGTCTC
TGCCGTTACCGTCTTTGGAGACCCAACATTTACACACGGACAAACCTTTGACGCTGGCACCGACACGAGCAGCGACGGGG
TAAGTAACCTGGTCCCCTTTTCGCCGATACGATGAAAAGGTCTTCTAACAGAAATTACAGATCTTCTCGCGCGGCCACTC
CAGCCTTGAGCTACTGAACACATATGCAGACAAGATCCAGAGCTACTGTGACGTAGGCGACGTCTACTGTGCGTCCGGCA
GCGACACAACTGCTCATCGTGAGGAGATTCCCACTTGGGCCACTGCGGCTGAAACATTTATCGTTAGCAAAAGCACATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62