GenePrediction:GLEAN_8241 Details

Name: GLEAN_8241
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:146143..144445 (- strand)
Length: 1699
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:146143..145531 (- strand)
Length: 613
Type: CDS
Source: GLEAN
Position: GCSC_113:145316..144445 (- strand)
Length: 872
>GLEAN_8241 class=GenePrediction position=GCSC_113:146143..144445 (- strand)
ATGCTGAATTCCAAAAAGCGCCAGGACTCCAATGCCATCATCACAGTTCACCAGTTCTCCATTGCAATGGCCACGACGGA
GACTCTACTAGAGAGCGACGGCTTCGTGCTCGTGTCGCACGCAGATGCGGTCGAGCTGGGCAGCAGAGAGGCCAGAGAGG
CCAGGGAGGTATCCGGCCGGTCGGCCTCACCGCCACGGTATCTCGCCGCAATCTCGGCGTGTGTCGACCAGGCCAGCGCG
TCTCTGTGGCCGCTCAATCGGCATATCCACGACCACCCGGAGCTGGCCTTTCACGAATTCGAGGCGCACCGACGGCTGAC
GGCCTTTTACGAAGGGCGCGCCATCGGCAGCGGCAACCACAGCGCACGCTGGACGGTCACGCGAGAGGCCTATGGTATGC
GCACAGCTTGGGTGGCCGTCTACGATAGCGGGCGAGCTGGGCCGGTCGTCTCGTTCAACGTCGAGATGGACGCGCTACCC
GGCGTCGGCCACGCCTGCGGCCACAACCTGATTGCCACGGCGTCTGTGGCCGGCAGCCTGGCGACAGCCGAGGTGATGTG
GCAGCATCGTCTCGGAGGAAAGATTGTCGTCTTTGGAACCCCGGCCGAAGAGGGTGAGTTCTGTTTGTTATCACGCTGTT
CCGTTCTTCGTTTCATCGTGCTCGTCATCCCCACTGTCCGTCTCTAGTTCCGTCTCCACCTTTTCGTTTCCACCGTTAGA
CTCTTCGTTCACCGTTCCGTTCCACCGTTCTGCTCTTCTTCGCTCATCATTCCGTCTCTTGCTTCACCCCCCTGATTCCC
CTCCCCTACTCCGTACTGACCCTTCAGATGGCGGTGGCAAGGTCTGCCTCCTCGAAGCCGGCGCCTACCGTGAGCATGGC
GCAGACGTGTCGCTCATCACGCACCCAAGCACGACGACGCCCAGCGCCATGATGCGCACGACAGCCATCACCAACTTCAT
GGCCTCGTACGAGGGCCGGGCAGCCCATGCGGCCGCGTCGCCGTGGCAGGGTGTCAACGCGCTGGACGCTCTCGTGCAGG
CGTACACGGGCCTCTCAATGCTGCGACAGCAGACGGCGCCGGGCGACATCATCCAGGGCCGCATCACCGACGGCGGCGCA
GCCACCAACATCATCCACGAGCACGCGGCCGGCGAGTTCGCCGTGCGAGCACCCTCGAAGCGTCGCCTCGCTGAGCTGCG
CCAAAAGGTTGACGGTTGCTTCCGTGCTGGTGCCGAGGCTACTGGCGCCCGTTTGACGCTTGATGAACGCGGCGGCTACG
CCGATCACATCCCCAACCGGCTGCTGGCCTGCGCGTATTCACGTTACTGGAACGAACTCGTGCGCCAGGACCCTGCCGTC
CCGGACGACGAGCACATCCCCGACAATCTCGACGTCGACGACGCCCGTGGAAGGACTCTTGCCAGTACCGATCAGGGCGA
CGTCAGCTACGCGATGCCCAGCCTCAGCGCCGGCTTCCGCATTCCGTCTATCCCCATCGACGGCAGCAGTCGTCCTGGTG
GTGGCCCCCACACTGTCGACTTTGAGCGCGCTGCAGGCACGCGCATCGCCTTTGAACATGCCTTGCGTGCTGGCAAGGGC
CTTGCGGGCACAGCCCTGGATGTGCTCACCGTCGACGGCCTCCTCGACCAGGTCAAGCGGGCTTGGAAGGAGGACATGGA
AGATGCAATGGTGTGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62