GenePrediction:GLEAN_8244 Details

Name: GLEAN_8244
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:123964..122595 (- strand)
Length: 1370
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:123964..123594 (- strand)
Length: 371
Type: CDS
Source: GLEAN
Position: GCSC_113:123540..122595 (- strand)
Length: 946
>GLEAN_8244 class=GenePrediction position=GCSC_113:123964..122595 (- strand)
ATGTCCCAGCTTCAGAGACCCGCCGGCCCTTGCCGAACTGCTTCCGCTAACAGTTTCGCCGAGACATTCAACATCGCTCG
GAGAAATCTCGAGAATCAGCTTTCTCACGAAGAACCGTCTTCTCTTGACCTTACGCCCTCAAACTCCACACCATTAACGT
CTCCGGCTTCATCAAACGCAACCACACCGGCGAGCCCAGCCACTCCCATCTCTCAGCCAATCACACCGTTTGGTGCAAGC
GAAGAGGTAGCCGACACGTTCGCTTTCGCCTTCGACATTGATGGAGTCCTCGTTCGGGGCGGCACGCCCATTCCAGAAGC
CATTGAGGCTATGAAGATGCTCAACGGAGAGAATGAGTACGGCATAAGAGTGTAAGTAGGACTGGCATAGAAGCCCCAGT
ACGTATTACTAACTAAAACTTTAGTCCGTACATTTTCCTCACCAATGGCGGCGGCAAGACTGAGGCTGAGCGGTGCGTCG
ATCTATCCGACCAGCTTCAAGTTGAGGTCAGCCCTGGCCAGTTCATCTGCGGGCACACTCCTATGAGAGAGCTTGCGGAC
AAGTACCGCGGTGCAGTCTTGGTTGTAGGCGGTGAGGGCGAGAAGTGCCGCACAGTAGCTGAGCATTACGGCTTCCGTGA
TGTTATTACCCCTGGAGATATCATCAAGACCAATGCAGCAGTCGCTCCGTTTCGGAAGCTAACCGAACTCGAGCACGCTA
ACTCTCAAGACCTGCTCGAGCGGGGCAACATCAACGATATTGTTATCGAAGCCATCTTTGTTTTCGCCGACAGCCGCGAC
TGGGCTTCCGATCTACAGATCATTCTGGATATTGCCATGTCCAAGGGTGGCCGACTCGACACTCGCTCGGAGACCTTCGA
CGAAGGTCCTCCAATCTTCTTTTCGCACAGCGACGTTGTGTGGTCTGCGGCTCATGAGAATGTCCGGTTGGGCATGGGCG
CTCTTCGCAGGATTGTTGAGACAATCTTCTCCGATGTGACCGGAGGCAAGAAACTTGTGACGCATGCCTTTGGCAAGCCT
CAGGTCAATACCTTTGAGTTTGCAACTCGCCTACTGCAGCAATGGCGTGCCACCCAGCACGGTCTTGATGACCACAGCAC
GCTGGACACGGTTTATTTTGTCGGCGATACGCCCGAGTCTGATGTCCGTGGCACCAATGCCATGGACGCCAAGTCGGAAA
ACACCTGGTACAGCATTCTCGTCAAGACGGGCGTGTACCAAGACGGCACAGAGCCAGCATATAAGCCACGTGCCACTGTG
CCGACCGTGCTGGACGCGGTCCGACATGGCATCGAGCGCGAGATGCAAGCGCGCATGCTCCGTCAAAGCAAGACGGACGC
CAAGGAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62