GenePrediction:GLEAN_8245 Details

Name: GLEAN_8245
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:120627..119981 (- strand)
Length: 647
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:120627..120154 (- strand)
Length: 474
Type: CDS
Source: GLEAN
Position: GCSC_113:119995..119981 (- strand)
Length: 15
>GLEAN_8245 class=GenePrediction position=GCSC_113:120627..119981 (- strand)
ATGGCCGACTCACAAAGCGGCATTAGTCCCCGAGACGATCCGCCTCCATACGAAGAAGCCCTCAACATGCTGAATGATCG
GGAACAACTTTTAGTGGTCGAGACGTCCATGTTTTGTGGCGCCTCAGAGCATGAAGTCATTGCTGGCCAGACTAATCCTT
CTGCCATCAGAGAACTTATCCACACGGCCATCGAAATTGCCGCCTCCCTTGCAGATCCACAAGACAATACCTCCCCGGCC
GCGACAGAGGCGGCAGAAAAAATGGGTGACGCTATCACAGCTGCTGCCATGGTCGTTGTCGACATCGAAAACAATTTGCC
GGCTGCAACATCACGACAGATTACGACAGGTTCTATAGAGGCAGCTCGCATTGCTGCACTATTAAATAAAGAGGGGCCGT
GTACTGCACGCACATTTGTCAATGGCCGTATCATGGCCAGCTACATACAATATGCCTTTTCAATAGGTCCAAATGTAAGA
GAGCTCGTCGATTCAAAAGCTCTGGCGGACGCATACCGATCTGCAACCGATGTAGTCCTTGCCTTGCCAAAATTTTCACG
AATTAAATTTCTTTACATCCTCGAGAAAGTCATCGGTCAAGTCGGCAAAGCTGTTGCAGAAACGCATCCTAGTGCAAGGA
GAAATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62