GenePrediction:GLEAN_8246 Details

Name: GLEAN_8246
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:108338..107068 (- strand)
Length: 1271
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:108338..108194 (- strand)
Length: 145
Type: CDS
Source: GLEAN
Position: GCSC_113:108103..107665 (- strand)
Length: 439
Type: CDS
Source: GLEAN
Position: GCSC_113:107605..107068 (- strand)
Length: 538
>GLEAN_8246 class=GenePrediction position=GCSC_113:108338..107068 (- strand)
ATGGAGCCCAACAATCGTCTCCGAGGGCTGAGAAGACTGTCTAGGCGAGATGACAGCTATGCCTTGGAGTACAATCGTGA
CCAGCTTGACCACCGAATACCTGCGATAGAAGCGTCTGACGACGAGGATGAGGACGATATTCTAGGTAGGGCCCTTTTTA
TTAGAGCATCCCACATAATGCTGGAACGTACATATAATTGAGGTTGCTCAAGACCTCCGGCTGACTGCCCTTAAGGTCGG
AGAATCAGATTTGGCCGTGCAGACATGGAGACAGCAGCTCCAGGCGAAGACACGGGCTCTCGCCCCCGTGGCAACGCCGT
ATTCCAACGTCACATGCGGGAAGAGGTATGGGCGCAGGACGAGCCGGAAGACGATGACAGCGGTGTGGACGAGACGAGCC
TCAGCGGTGTGGACAACGGCGACGCGACCGACAGCGACGGCCTGACGGGGCACTACGGAGAGATAGCGGACGAGGACCTG
CTGGACGAGCAAGACGGCGACTTTGAGTTTGGGTCGCAGCAGGACATGCCTAATGACGAGCCGATGATCTCGTTCGACCC
AATGCTCTTGGGCCTGAAGGAGATCAACAACCTGGCGCATTTCAGCGTGAGCAGCCACAAGCCGGGGAACGGCGTGGATG
AGCTCCTCATCGACGACCTGAACAAGTACTGGCAGTAAGTTTCTGCGCAGCAGATCGACAGAGAGGGTAAAGCTGTGATT
GACACGTTGGCAGATCGGACGGCCCGCAGCCACACCTGCTGACGATACATTTCCTGCGACGGGTGGAGATTCGGGCGATT
CGATTCTACGTAGATTACAACCAGGACGAGTCGTACACGCCGACGGTGGTGATGCTATCGGCGGGAACAGGCCACCACGA
TCTGATCGAGTTTGCGACGCTGTCGATGACCAGCCCGGTGGGATGGCAGGAAGTCGACCTCAGCGGGGCCGGAGGCGGCA
ACGACGGTCAATCGCTCTGCTGTTGGATCGTGCAGGTGAAGGTTAAGGAAAATCACCAGAACGGCAAGGACACGCATATC
CGGGGCATCAAGATCTACGCGCTCGACGAGAACGCGCCGCCGGCAGACATGGCGCTAGATGAGCTTGCCCTGGTGAAGGC
GCGGGCGTTGCGGGCAGTCAAGGACGACGCGATGGCCGGGGACGACTATCTCTTCGAGCGGCTCATGGCCCAGTCTCCCG
ACCGGCTTCCTGGCATCCCGGAACGGTCGGGTAGCATCTCAAACTTCCTAAGGGACTCAGAAATCCGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62