GenePrediction:GLEAN_8247 Details

Name: GLEAN_8247
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:102170..101146 (- strand)
Length: 1025
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:102170..101611 (- strand)
Length: 560
Type: CDS
Source: GLEAN
Position: GCSC_113:101536..101402 (- strand)
Length: 135
Type: CDS
Source: GLEAN
Position: GCSC_113:101347..101146 (- strand)
Length: 202
>GLEAN_8247 class=GenePrediction position=GCSC_113:102170..101146 (- strand)
ATGCCCTACAGCTGGACACATCTCGTCCGTTTTTTGGCCAAGGAGGACGGTCAGGTCCACCTAGGCCAGATCGATGCTGC
CAAGGTGCCCGACCTAGGCCTAGCGCTCGAGAAGGGCGAGACGGTGACGGTGCAAGTCGTCGAAGGCGACGTGTTTGACG
GGGTAGTAACAAACAGGACACTGACCATCTCAACGGTGAGCTTTGGGCTGTTAGCGGTCGTCTTTTTGACACCCTGGCTG
ACTCGGGCACTTTTGAACAACTGCTCGCGCTACTGCGCCAAGATCAGGTGCCCCTTATCCGCTGCATGGGACTCAACTAC
CGCGACCACGCCAAGGAGGCCGGCATGCCGATTCCAGACACTTCATCAAGCCGCGGACGGCGCAGGCAGGCCCGTCCCCG
CGCGAATCGTCGTGCCCAAGATCGCGCAGGACGGCACAAGCGACTACGAGGCAGAGCTGTCGCTGGTCATCGGCAAGACA
GGCCGCGACATTCCCAAAGAGCAGGCACTGGACTACATGCTGGGCTATACGGCGAGCAACGACGTCAGCGCACGGGCCCA
GTAGCTCAAGAACAGCCAGTGGTGCTTTTCCAAGGGTGAGGGCGGGCGAGGCAGAGAAGAACACGGCAGAGCAGCACTGA
CGGCACAGGTCTCGACGCGTCGGCTCCCATTGGGCCGGTCTTGGTAGCGGCATCTGCCATCGTCGATCCTCACAGGCTCA
AGATCAAGGCAATTCTCAACGGTGAGGTCGTCCAGAACTCCAACACGAGGTGAGGCCGTTCCCGCGGCCTTGACGTCATC
CCTCCTGCCGCTGACATGCACAGCGAGATGATCTTCGATATCCCAACGACAATCGCGTTCCTGTCACAGGGCACGACGCT
GGAGCGTGGCACAATCATCATGACGGGCACCGGCCCCGGCATCGGAGCTATGCGCACGCCCAAGCTCTCGCTAAAACACG
AAGACGACATCCGCGTCGAGATTGAGAAGATCGGCACGCTGATCAACAAGGTCTACCACGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62