GenePrediction:GLEAN_8248 Details

Name: GLEAN_8248
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:98154..96572 (- strand)
Length: 1583
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:98154..97843 (- strand)
Length: 312
Type: CDS
Source: GLEAN
Position: GCSC_113:97783..97024 (- strand)
Length: 760
Type: CDS
Source: GLEAN
Position: GCSC_113:96963..96572 (- strand)
Length: 392
>GLEAN_8248 class=GenePrediction position=GCSC_113:98154..96572 (- strand)
ATGAAGGCTTCCCAGCATAATGTCGCCGCCGCCTTGGCCATTGTCGGTCTGGGCTTGCATGCCGCAATCACCTCTGCCGC
GAGCTGCTCCACGGTCCTTACCCCGTCCTACAACACGCCGGTTGTAGCCAGCGGCTGGACCGCACAGATCGTCGCCAATG
GCCTGCACAAGCCGCGCAGCATCCAGTTTGATAGTTCCGGCAGCCTGCTGGTCGTTGAGAGCGGAAAGGGCGTTTCGCGC
ATCGTCTTCACTGACAAGGGCAAGACCTGTCTGGAGGTGGCCTCGTACACGACCGTTGTAAACGACACCAGTGTATGCCA
CCTCTCCTCCCTTTCCATCTGTCCCGTCCCCTCATATACTGACCTCTCCAGCTGAACCACGGCCTCGTGTTGACGGCCAA
CGAAACCGTCCTGCTGGCCTCGTCCGTCGCGGCCGTCAATGCCTACGTCTACGATGCTAAGACCGGCAGCGTCAGCGGCA
GCTCCCAGACCGTTGTCTCCGGCATGAGCAACAACGACCTGACCACGCGCACGCTGCTCATGTCGACCGCCAAGGATGGT
ACGCTGCTGGTGTCGCGCGGCAGCTCCGAGGACTACGACGAGGACGCGCTGAATGTCAAGTCCGGCCTGTCGCAGATTCG
TGCCTTTGACCTGAGCTCGCTCACGGCGTCGTCCTCGGACGTCTCTGCTTACGACTTTGACACCGCCGGCCTGCGCGTCG
GCTGGGGCTTGCGCAACTCGGTCGGCATGGCCGAGCACCCCGTCACCGGCGGCATCTTCGCTGTCGAGAACAGCATTGAC
GATGCCACCCGCGAGGGCACCGACATCCACGAGAACAACCCGGGCGAGGAGCTCAACTACCTCGGCACCCTGTCGGATTT
GTCGTCCTCCAAACAGGGCAGCAACTACGGCTACCCCAACTGCTTTGCCGTCTGGAACACATCCATCCCCGACAATGCTG
GCCTCGTTGTCGGCAGCCAGGTCAGCATGATCGTCAACAGCACCTACAACGACACCACCTGCGCCGACACCACCGTGTCG
CCGCGCCTTACCTTCCCGGCTCACATGGCTCCTCTGGACATTATTTTCACATCCGACGGTGCAACCGCCTACGTCACCTT
CCATGGAAGCAGTAAGACAGCCCTGTTCCACTCTCTCCCCATGTCCCTGGTTCCAAGCTGACCCTCAATAGCCGACAAGA
CGGCCAAGGTCGGCTACCATCTGTCTAGTCTCGAATTCAACAGCACCACCGGATCGCCCGTCGACGACGACACCAGCACG
ACTGCTCTGACCACCATCCTGTCCAACCCAGATCTCACCCAGTGTCCTGGAGCCTGCTTCCGTCCCGTGGGCCTCGCATG
GGATGCCTCTGGCCGTCTGTTCATGTCGTCCGATGCCACTGGCGAAATTTATGTCCTACTCAAGTCTTCCTCCACCGCCA
CTTCCACTGCCAGCGGCACCATGGTGACGCCCACAAGCAGCGCTAAGAGCGCCGCGGCACCTGCCGCCCTCTTCAGCCGG
ACCACGGCTCTGCTGGCCGTTGCATTGACCGGATCGGCGACGGTGCTGCTGAGTGCGTTTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62