GenePrediction:GLEAN_8250 Details

Name: GLEAN_8250
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:79978..79038 (- strand)
Length: 941
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:79978..79602 (- strand)
Length: 377
Type: CDS
Source: GLEAN
Position: GCSC_113:79401..79038 (- strand)
Length: 364
>GLEAN_8250 class=GenePrediction position=GCSC_113:79978..79038 (- strand)
ATGGTCACCCTATGGCAGCTATTTTACGTCTTAGCATCACCGTTCATCAAGATCAGCATTTGTGCGAACCTGATCCGAAT
CGCCACACAGCGCCGCTACGTCTACCCGTTATACTTAGCTTCGCTCCTCAGCACAGCCATGACTGTCATGGCTTTCATCA
TCGTCTTTATTCAATGCATTCCCTTTACAGCCTCCTGGACCGGGAACGGGAAATGTATCTCGATTAGAATCATCATCATT
CCCACATATGTCTTCTCCGCAGTCAACATCTTTGTGGACTGGGTCGTTGCCATCTTGCCAGCATTTATCTTGTGGGACCT
CCAGCTTCGCCGGAAGCTAAAGCTCTTGTGTTATTCTATCTTAGCCGTGGGTGTTTTGTAAGTTTTTCTTCTTCACTGGC
TAGAACTGGCCAAATCGTTGCCCGCTGATGATAGATATCGTTCTAATTGATTTGGACTAGTGCTTCCGTTGCTACCATCA
TTCGAATGCCGCATGTGGCGTCTTACTCAGCACAAAACAATAAGCTTTGTAAGTCTGGACCAGCCCCGACCTTTTGAATC
TTTCAAATTTGCACCAGGCTGATTTGCGGCAATTTTTCATGTATAGACAAGATTGGCGACGTTATCGTTTGGACGGTAGT
TGAGCTTAGCCTTGGAATTCTTGCGGGATCCCTACCTTCGCTGCGCAAACTGTTCAAGAGTCTTTCAGCAGACCACAGTA
CCGGTGATCAATCATACGGAACCGACCTTCCGACGTTGGGACGGAGAAAGAGAAACCGAGCTACACAGAACGATACGTAC
GACTGCGAGCTGAACATAACTGTGAGAGCCGAGAGGGACGGTAGCAGTGACGGTGCCCCAGAGAAGGATGACGATAGTAC
GCGACATATCATCCACGTCACGCGAGATGTCACCCAGGTCTCTATCCAGGAGGCCCCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62