GenePrediction:GLEAN_8252 Details

Name: GLEAN_8252
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:55421..54888 (- strand)
Length: 534
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:55421..55373 (- strand)
Length: 49
Type: CDS
Source: GLEAN
Position: GCSC_113:55208..55125 (- strand)
Length: 84
Type: CDS
Source: GLEAN
Position: GCSC_113:55066..54888 (- strand)
Length: 179
>GLEAN_8252 class=GenePrediction position=GCSC_113:55421..54888 (- strand)
ATGCCCTCCGGAAGCTGTCTTTGTGGCAAGATTGCCTTCTCATTCTTGGGTAAGTCATGTTGCGCTTCGGTACTTGAACC
AGAAACTATCGAAAAAATAAAGCTAATACAACCATCAGTCGAGCCGGCTCTCACAGCTCTCTGCCACTGTGTAGACTGTC
AGAAGTGGGGGAGGGTGGTGGTTACAGCTCGAATGTGGCTATCCCCACCATAGACTTCCATATAACACAGGGCACGCCCA
AGAAGTTTGTTCGCAAGGGTATTTCGGGTCTTGACCAACGCCTGTTTTTCTGCGGCGGTAAGTTGAGACTGTCTTTCGAA
TGGAACCGGTACTAGATCCAACTAATACGATGCAGATTGCGGAACTAATCTGTTCGTCCAGCCCGAGTCCATGGAAGGCA
CAACGTTGGTCAGGGCCGGCTCCCTTGGTGATAGCGCATCGGATTTTCCCATCAAGGTCGAATTCTTCACCAAGGACCGT
CGCAGCTACAACACTCCTGTGCAAGATGCTCAACAGAACATAGCCAATACTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62