GenePrediction:GLEAN_8264 Details

Name: GLEAN_8264
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_124:241299..240530 (- strand)
Length: 770
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_124:241299..241249 (- strand)
Length: 51
Type: CDS
Source: GLEAN
Position: GCSC_124:241176..241099 (- strand)
Length: 78
Type: CDS
Source: GLEAN
Position: GCSC_124:241030..240530 (- strand)
Length: 501
>GLEAN_8264 class=GenePrediction position=GCSC_124:241299..240530 (- strand)
ATGTCGCAAAAACAGCTCGCCCGCGACATGCAGACGGAGTTCCAGGCTCGGGTAGGCTGATCGGATCACGCTGGACAAGC
TGAGCACTCTATCCAGAGAGCTCGAATACTGACCTGGATATAGTTTCACGCCAAGCAGGCCCGTCGCGAGTCACAGAAGG
CAGCCAAGCAGGACGGCGAGCTGCGGAAACAGATCCAGAATGTGGGTGTCTTGGGTGGCTGCCTCATGCTGAAAGTCGAA
ATAGCTTCATGTTTGTGCTGACGTGCCAGCTCCTCAAAAAAGGGGAAACCCAGCAGGCAGCCCAGAAGGCACGGATGCTG
CTAGCCAAGCAAGCCATCGCCACGCAGATGGACCAGGCGGCCGACATGGCCGAGTTATCGGTGGCACAGATCCAAGCCAA
CAACGCGATGAACCGGATGACGGCCATGATGCAGCAGTCGTCGCGCACGATGAGCCGGGCGCAGCGCAGCGTCAACCCGG
AGCGCACGTTGGTGGCCTTGGAGCAGTACCGGACGCAGAACGAGGACTACGCCATGTCCAACAGCATCTACACCGACGCC
ATGACTCAGAACACGTCTGTCCAGGTGTCCGACGACGCCGTCCACGAGCTTCTGGGCAAGCTGGCCGACGATGCCGGCGT
TGAGCTGTCGCAGGAGCTCAACTCAGCCCAGGTCAGCAAGACGGAGCCGGTGCGCGAGCCGGCCGCTGCCGAGCCGACGG
CCGAGGAGGAGGATGCCTTGCAGCAGCGGTTGAGGGCATTGAGGGCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62