GenePrediction:GLEAN_8265 Details

Name: GLEAN_8265
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_124:234625..233786 (- strand)
Length: 840
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_124:234625..234566 (- strand)
Length: 60
Type: CDS
Source: GLEAN
Position: GCSC_124:234459..234443 (- strand)
Length: 17
Type: CDS
Source: GLEAN
Position: GCSC_124:234333..234128 (- strand)
Length: 206
Type: CDS
Source: GLEAN
Position: GCSC_124:234057..233786 (- strand)
Length: 272
>GLEAN_8265 class=GenePrediction position=GCSC_124:234625..233786 (- strand)
ATGGCGAATCCCACAGCACCGACGTACATCCCCAGCCGGGTGGTCCAGACCGACTATCCTGTGAGTTTGCCACAGCCAAT
TGGCAACCAGGCCGACCGGACGAGCCGCCTGCATCTGTGCACCTGTTTGGAGCGAAGTTTTAGCTGACAATGTTGCCTAT
ATATAGCTCATCGACAATGACCCGTAAGCGCACACCACGATTCGGAGAGAACTTCCGCGGAAAGCCCTCGCGGCGACCTC
CCCAAGCTTCCTGGCTCCGATTTGCGTATTCCGCCTTCTGACAGCTGTCCAGACACTACAAGCGGGTGATCCGATATGCC
CGGCCGTCCGACTACGCGCACGGCGCAGTGGCAGCGGCGGCTGGCCCAACAACGCTCCTGCTGATGGAGCGGCTTGCACC
GTCGTACGTCGGCAAGGGCGGCTTTGCCCAGGCCATGCGGCTAGGCGGCTTCCTCGGTCTGGCCGGCGGCTTCCTCTACT
TTTACCAACGATCATGCTGTAAGTTTGGGGAGGCGGAGCGGAAGAAGGAATGATAGACGGAGCGAGACGGTTGGATGCTA
ACATACAGTGCGCTTCTATGGCATGTCGGAGAACGCCCGCGAGGTGGAGATGGACATGAACGAAATGGTGGCCAAGGTCA
AGGCGGGCGAGACGCTCTACGGCGAGAGCCGACTGACGCCGCACATGCAGGGCGTGGCGGCGCGGCAGTCACGCTACTCG
GCGCTGTTCTTCCAGGTGGTGCCGTGGTTTAACTTTGTCAACCATGGACAGCACGGCGTGGACACGGCCAAGTACTACCA
GCAGGCGGAGCGGGAGCTGGCGGGCGAAAAGGCGAAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62