GenePrediction:GLEAN_8267 Details

Name: GLEAN_8267
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_124:221277..220808 (- strand)
Length: 470
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_124:221277..221072 (- strand)
Length: 206
Type: CDS
Source: GLEAN
Position: GCSC_124:220967..220808 (- strand)
Length: 160
>GLEAN_8267 class=GenePrediction position=GCSC_124:221277..220808 (- strand)
ATGATGTGGCTTTCCATCCCACTTTCCCAGTCGGTGGCTCCAGGCCCCGAGCCGCCCACAAAGCAGCCCATGGGCCAAGC
CCGGGCCCCGCCGCAGTACACGTATGCGCGTATTTCAGTAGCAGCAGGCGGCCCAGAACAGGTGGGCCGCTGCTATAGGA
TACCTGCAGCTTTGTACCGCTCTAGACACTCGTCCGACCTATGGTCGTAAGACGGCCGACAGCAGTGGTTCGGTTTCTGG
ACATAGGGCCATTCTTTCCCATGGGCGGGGCTTCCGTTTAGTTGTGCATCGCGAACATCGACAAACGAAGCCGGCAAAAG
TCGACGGTGCATCTCGATGGCCGTGCCGGCCGGCCATGGGACCAAGGGGCTCAGACCGCGGAGGAGGGAAGCTACTTATA
TACAGACAGGTCCGGTCGCAAGTCGTTCCACCCGCAGAGAAGGCTCACCACCATCATCGAGCCCAACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62