GenePrediction:GLEAN_8269 Details

Name: GLEAN_8269
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_124:213661..210304 (- strand)
Length: 3358
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_124:213661..210420 (- strand)
Length: 3242
Type: CDS
Source: GLEAN
Position: GCSC_124:210355..210304 (- strand)
Length: 52
>GLEAN_8269 class=GenePrediction position=GCSC_124:213661..210304 (- strand)
ATGATGATGCTAACTAGTGTACAGAGAATCAGAGGCGCGATAGATCGGACGATTGCCGAAGAGCAGGCACGTCAGCAGAG
GACAGGCGAGCACGCCGGATCATCGGGCGGATCGTCGCCGAGCAGAAGATCGTCGACATCGGTGTCACGAACAGGAAGCG
TCAAGGGCGAGGGTACGGCAGCCGGACGACGGGCGCGATCAACGCGACCGAGCCAGGACAACGGCAACAAGGGCAGCGAG
GGTACGGCGAACACGGACCCGTCTGTATTCGAGGCGGCCTTTGTGATCGACGACAGCGAGGAGCCGTCGCGGACGTCGAC
ACCGATGCCGGCAGAAGCTGGGAACGGCAGCGAGGAGAAGGAGGGTGCGAGAGGGAGCGAGGAGAAAGAGACGAGAGACG
AGGTATCGCTAGCCAGACAAGATGGCACCGACGGCAGAAACAAGGACGAGGCTGGCGAGACAGCCGACAGGACGGCAAAG
ACGATGACGACGCGGCCAGACAAAACGGAGCTGCCCCCAGAGATCCGGGCGCGGCTGCGCAAGCTGGAGAAGCTGGAGGC
GACATATCCGGAGCTGCTGCGGTCGTACCGGGTGGCGCACGGGAGGGCGACGTCGATCGAACCGTTTGAGAGGGTGTTGC
GCGAGAACACGCCATTGGGGTCGATCCGTGACCCAGAGGCGTTGGTGGAGTACCTCGGACAGCTGAGTCTCAAGAGCGAC
ATGGTGCTAGAGGAGCTAAAGCGAGTGTCAGGCGAGCGCGACGGGCTGCGGAAGAAGCTGGACGAGGCGGAGGCCGAGGT
GGCGGAGGCGAGGAAGCACGTCAAGAAGCCAGAGGACGGCAGCGAGGAGTTCTTCTCAGCCGACAGCGAGCTGCCACGGC
TGCAGGCGGCCGAGCAGACGGAGCAGATCGGGAAGCTGCGCGATGAGGTTGCGGCGAAGACGACAGAGTCGGCAGTGAAG
ACACAGCAGATCGAGAAGCTTCAGCAGGATGCGACAGCAAAGACAGAGCAAATCGAGAGGCTCGAGAAGGAAGTAGAGCA
GCTGCAGACAGACCTTTCGGCGGCGATTCAGACAAAGACGGAGGTGGCCGCACTCAACGCACAGTTGACGACGACAGCAG
CCAAGAACGGAGAGTTGGAGGGCGAGGCTCAGGCACTGACTAAGCAGCTCGACAAGACAGTGGCGGCGACAAAGACTGAG
AAGGAAAAGCTGGCGAAGGAGAAGAAGGAGCGGGACACTTTGATCGAGCAGCTGCTGAAGGCGGCAGCGGCACCACGGCC
AGCAGTGGTACCTGCAGCTGCGGCGGCAGCACCGACGACAACGACACAGACACCGACAGGCACGAGCGGCGGAGCAAAAA
AGAAGAACAAGAAGAAGAAGAAGAACAACGGTGGTGGTGGGGTGGCGGCAGCAGCAGCAACGGCAGCAGCAGCCGCAGCG
ATGGAACCGGCGCCGTCAGAAGCATCCGAATTGACGCTGGTAGGAGCTGCAGATGGCGAAGTGGAGGCCGAGAGCGAGGC
AGCTCCCGATGCAGCAGCAATGGCAGAGCTGCAGGCAGAGTTGCAGGCGGAGGTGACCCGACTGCAGGCAGAGGCAGCCA
GTAAAGACGCGCAGATCGAGCGACTAGGACGCCAGCGGAAAACAGAGGAGGACCTGCGGGAGGAGATTGAGACGCTGCAG
GAGAATCTGTTGGCCATCGGGCAGGACCACGTGGAGGCCAAGGAGAGGATCAAGGAGCTGCAGGCGGCGGGGGCAGAGAC
GACACAGCTGCAAGAACGGGTGGCCTCGCTGGAGCAGGAGCGGGAGACGCTGACGCAAACGGTGACAACACTACAGAAGG
AGAGAGAGGCGCTGACGAAGACGGTGGCCTCACTGGAGCAGGAGCGCGCTGGACTGCAGTCGGAGGTGGGCGCGGCACAG
CAGCTGGCGGCAAGCCGGTTTAAGGACGCGACAGAGCTGCGGGAGGTGCTGCAGAAGGCACAGCCTGAGCTGAAGAGTCT
GCGACAAGAGGCAGCACAGCTGAAGACGGTGCGGTCAGAGCTGGCAGCAAAGACGGCCGAGGCGACGGCGGCGGAGAAGC
GGGAGAAGGAGGCCAAGCTGGAGGCGGCGCGGGCGACACGACTGGCGAGCGAGCGCGAGGCAGAGGCGAAGGGGCTGCGG
GAGAAGCTGACGGGCGAGACGGGGCAGCGAGCACGGCTTGAGGATGAGAAGCGAACGATGGGACGCGATCTGCGGCGGGC
AGAAGGCGAGAAGGCCGAGCAGCAGGTACGGGCCGAAAAGGCCGAGCAGCAGGCGACACGGCAGCAGGAAGAGGCAGGCC
AGCAGCGACGGCGAACAGCACAACTGGAAGAAGAGGCGAGCCGGTTGCGACGCGAGGAGGCGGCACAGCGCGAAGAGGTG
GTACGCAAGACGGCACAGTACGCGAACGCGCAGAAGCTGCTGGCAAGCATGCGAGACCAGACAGCCGAGGTGGGGGTGCA
GCTGCGAGAGGCACAGGCAGCGACCGAGGCACTGGACGAGGAGCTGGCCGAGTGTCGGCGGCTGCTGGGCGAGCGGACGC
GGGAAGCCGAGACGATGCGACGACTGCTGGCCGACGTGGACGGCCGGGCAGACGGAAAGGTGCGGGCGATGCAGGCACAG
CTAGACGCGGCCGTGGCCGAACGCGAGCGGCTGGAAGATGAAGCAGGCGTGGCAGCACGACGTCGCAGCCGCGAGGCCGA
GGAGCTGCGCACGCGGGCGCGCGAGCTGGAGCGGCGAGCTGAAGCGGCAGTGGCTGAGCGCGACGGGCTGCAGGCGCGGG
CAGCGGAGCTGGCACAGCAATTATCGGCACAGGAGTCGGAAACAGCGGCTGCAGCCGAGCAGACGGCCGCACTGACAACG
ACGGTGGCCAGTCTGCGAGCAGCACTCGACGGGGCCGAGCAGGCGGTGCGGGATGCCGAGCGACAGCGGGCGGACCTGCG
GCGGGTGCTGGACGAGCAGCGACAGCGGTTTGAAAAGGCGCGGGCGAGTGGTGGTGGAAGCGCAGGCAGAGGACGGCCGA
CGACGGCTGACACATCTTCGACAACACCCGTCCGCAAGTCGATCGACAGCAACAGCAGCCGGCCGTCCTCTTCGGCGGCC
ACGCCAGCGGCTCCCGATGCCGTCTACATCAAGACAATCATGCTGCAGTTCCTTGAGCAGAAGGACAACCGGCTGCGTGC
ACAGCTGGTGCCGGTGCTGGGCAAGCTGCTGCGCTTTGATCGGTACGTGTGTGTGTTGGATGTGTTGGATATATTGGATT
TAGGAAATGCACGCTAACAGATTTAGTGCCGACGAGCAAAAGTGGCTGGCAGCCATCCAGCATCTGACGGCGAGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62