GenePrediction:GLEAN_826 Details

Name: GLEAN_826
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:254783..258044 (+ strand)
Length: 3262
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:254783..256086 (+ strand)
Length: 1304
Type: CDS
Source: GLEAN
Position: GCSC_132:256142..257211 (+ strand)
Length: 1070
Type: CDS
Source: GLEAN
Position: GCSC_132:257713..258044 (+ strand)
Length: 332
>GLEAN_826 class=GenePrediction position=GCSC_132:254783..258044 (+ strand)
ATGTTGCCCAAGAATCTGATTCAGCTGATGGCTGCCGGCCTCGTGGCCAGCGCCTCGGCTGCTGCCGTCAACTCTGATGC
TGCCCTACGGGAGTTGCAGCAGCGCGAAGCCAACCGACCGCACCTCCATTGGCTGCGTGCCGCGTCCGTGTCCAACACCA
GCTCTTCGGCCAACCCGACTAGTGTCGAGAGCTCTTCTATCGAGAGTTCGTCTACGCCGGCCACCAGCTCAGCGTCAACT
TCGTCGGAGCTGACTTCATCTGCTTCGTCCGCAAGTTCTACGCCTATCTCTATAGTCGCCAGCTCTACACCGACCTCGTC
TGTTGCTTCATCTTCGGTTGCATCCTCATCAGCTGCGTCATCCTCGGTCTCATCATCCTCGGCTGCTTCGTCAGTTTCCA
GCTCAGTTGCTTCGTCGAGTGCCAGCAGTTCTGCAGCCGCCAGCAGCTCCGCCCCCGTTAGCTCAACTGCCAGCAGCTCT
GCCCCCATCAGCTCGGCTTCTGCTAGCAGCTTAGTTACTGCTAGCAGCTCTGCACCTACCAGCTCTTCTGTCGCCAGCAA
CTCGACTAGCTCGTCTCCTGTCAGCTCTACTGCTAGCAGCTCTGCACCTGCCAGCTCTTCTATCGCTAGCAACTCTACCA
GCTCGGCTCCAGCTATCTCTTCTGCCAGCTCTTCTGCCCTGGCCGTCAGCTCTGTTGCAAGCAACTCGACCAGCTCTTCT
CCTGCCAGCTCTACTGCGGCAATCTCGGTTCCCTTGAGCACTGCGCCTACCAGCTCCGTAGCCTCTAGCTCTGCTGCCGC
CAGCTCATCGGTTCCGTTTACAAACTCAACCAGCTCAACTCCCGTTAGCAGCTCTGCTCCGGTCAGCAGCTCTTCTACCA
ATTCAACCAGCTCTGCTCCTGCTAGCTCTGCCCCAGTTAGCTCTCCTGCTTCTGCTAGCAGCGCTCCTAGCAACAGCACC
AGCTCAGCTCCGGCCAGCTCTTCTGCTCCGATAAGCAGCTCTCCTAGCAACTCTACGAGCTCTGCCCCGGCTACCAGCTC
GGCACTGGCTAGCTCTTCTGCCCCGACCAGCAGTTCTCCCAGCAATTCGACTGCCCCGGCTTCTACCGCCACTTCGGCTT
CGCCGACATCATCTGGCAGTATCCTCCCGACGATTCCCCCCCACATTGGCCACTACAGCTACATCGGCTGCTTCGGCCCG
TCTCAGGCACACCCGTTCGTCCAGAAGCACAGCGATTCTGCCATGACCCTCGACCTCTGCGTCGCTACCTGCGATGGAGT
TCCCTTTGTCGGCATCTTTACCAAGTAAGCCCGATCCCTTGTCTTTTAACCTTTGAAAACATGCTGACAGACAAATCAGC
GACTGCTACTGCTTCAACTCAAACCTGGGCAACACCCGCTTTACCGACAGCCACTGTCTGACACCTTGCCCTGGCAACGC
CCACGAAGGCTGCGGTGGCATTCGCCCTAGTCTGAAGCGTCGTGACAGCCTGCCGACCGAGGACGTCCTCGTCGTCTATG
CCTATGACAACAGCACCTCGTCGTCTGCTTCTGCTTCGTCCACGGCCTCCAGCGCTGCTTACAGCGTGTCTGGTGCTGTC
TCGTCTTCTGGTGCCGCTGCTTCGAGCGTCTCTGGTGCTGCTTCTTCGAGCGTTTCGGGTGCTGTCTCTTCTAGCGTTGC
TTCTTCTGGTCTGTACACCAACAGCACCTCGTCTGCTGCTGCTGGCTCTACTGCCACCGTCTTGGCTACGGTCTCCACTA
CTGCTTCCCTCACCGGTGCCGTTTCTGGTACTGCCACCTCAGCTGGTGCTGCCACTGCCGCTGTCGCCACTACCACCACC
ATCGAGACCACCACAGTCACGGTCACCACCTGTGTCGGTGGCACGTCTACTGTCATCGGAGGCGAGACTACCACAGTTGG
CGGCTCATCTACTGTCATTGGTGGTGTGACGACCACAGTTGGTGGTACATCGACTGTCATTGGTGGTGAGACAACCACGG
TTGGCGGTACATCTACTGTCATTGGCGGTGCGACCACCACCGTTGGTGGCCTGAGCACCGTCATCACGGCCACAGCCACT
GTCGTCCCGTCGACGACTGTGATCGATATCAGCATCTACTTCATCTTTGTCGAGTGCACCGCCACGCCGACTGTCGATGA
GGTTGTCTACGTCATCGAGGAGTGCGGCTGCAAGGGTGGTGTTTCTTACGTCGTCGCCGATGTCACCGTCGCTATCGCCA
AGGGTCTGACTATCTACCGCGCTGTTGCCTGTGACAGCACCACCGTCTCGACTGGTGTCACCGTCTACTCCGCACAGTCC
TGCGACAGTTGCACGGGTGGTTACGTCTTTGTCAGCGCCGAGGTCGGCGCTTCGGCCTCGGCTTCCTCGTCTGAGACTGT
CATCGTATCCTACCTAAAGAGCGGTAGCGGTGTCTCTGCTGTCTACTCCACCTCGACGTATGCAACCACCGTCACCATCG
GTGCTGCTGCTGAGGCTACTGCCGGTGCTTCTGCTGGTGCCGTGGCCGCTGCTGGATCTGGTTCTAGCTCTGGTTCAAGC
TCTGGTTCAAACTCTGGCTCTAGCTCGGGCTCTACTGTTGGCTCTAGCTCCGGATCTTCTACTGGCTTCAGCTCTGGTTC
CAGTTTTGGATCTTCTGCTGGTTCAAGCTCTGGTTCAAGCTCTGGCTCTGGCTCTAGCTCGAGCTCCAGCTCTGACTCCA
GCTCCGGTTCTACTGCTGGTTCAAGCTCTGGTTCAAGCTCTGGCTCCAGCTCGAGCTCCAGCTCGGGCTCTAGCACAGGC
TCTAGCTCTGGATCTGCTGCTGGATCTGCTTCTAGCTCTAGCTCTGAGTCTACTGCTGGCTCCAGCTCTGAATCCACTAG
TGGCTCCATCTCTGGATCTGCTGCTGGCTCTGGCTCTGGCTCTAGCACAGGCTCCAGCTCCGAGGCTGGCTCGGGCTCCA
GCACTGAGCCCAACACTGACACTGCTGCGGGTTCCAGCTCTGGTTCTAGCTCTGGCAGCTCGGCTGCTGGTGCTGGCGCC
ATCGCTGGCTCCGGCTCCGGCTACAACTCTACGTCTGGCTACAACGCCAGCGTTGTGTATGCATCTGGATCCGGAACTGC
CACCCCTGTCGCAGTCGTGTCGTCCACTTCGGCGACGGCGGCTGTCTCGGCTACCTTGGTCGTTACCGCTGGCGCTTCCG
TTGTGGCTACCAACTCGGGCGTCTTCTTTGCGTCTCTTGCTGCCCTCTTCTTGCTGCTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62