GenePrediction:GLEAN_8270 Details

Name: GLEAN_8270
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_124:201378..199583 (- strand)
Length: 1796
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_124:201378..200717 (- strand)
Length: 662
Type: CDS
Source: GLEAN
Position: GCSC_124:200650..200514 (- strand)
Length: 137
Type: CDS
Source: GLEAN
Position: GCSC_124:200456..200255 (- strand)
Length: 202
Type: CDS
Source: GLEAN
Position: GCSC_124:200190..200031 (- strand)
Length: 160
Type: CDS
Source: GLEAN
Position: GCSC_124:199970..199698 (- strand)
Length: 273
Type: CDS
Source: GLEAN
Position: GCSC_124:199630..199583 (- strand)
Length: 48
>GLEAN_8270 class=GenePrediction position=GCSC_124:201378..199583 (- strand)
ATGGAAGACCAGCTACGGGGTGAAATACGCGAGCTGCAAGAGGCTGTTGATAGGCTGTCAGCCAACCCAAAGGCAGACTC
AGAGGCCAAACAGAAAGCAGCGGCAACCAGCGACGTCTCAACCGGCTCTGTAGAGGATACACTACTACTGCAACAGGACG
TTGTCGCTCGGGGACTCGTGACTGAGTCTGAATGGAATGATTTGTACTCATTGTTCGTTCAAGCCTTCCTGCCCTCCCTG
GTCATCCGAATTAACGATTGCAGCTATCAAACAAAGTGCAGGGAGGTCATCGCCCTCGTGGATGACCAGATTTATCCACC
TGCATCCGTCATCCGGCGGCATCCGCTGCTGTCCACTACCATCTGCGTGATTGCAGGAAGGTCGCTGATCCCCGGGCGCT
ACCGCTCTTTCGTCGACGAGGGTGATGCTCTGATCTGCAAGACGTTCCAGGGCGTGGACATGGATCTGCTCGGCTTCTAT
GCCATCATGCTGCTCACCGCCTGGACCGGCCGGGCTCGGCTGTGGGGCTACGCTGCCTCGCTAGCTTATGACATGCAGCT
GCACCTGTCCGCCCTACAGTTCCGGGACGAAGCAGCGGAGAGCACAGAATCGGTGGTGGAACGCGCTCGCGCCTGGTTCA
CGCTATGCGGCTTTGACTTGATGTGCGTGGGAGCGAGGCATGGCTGAGAGGCAAGGCGGGGCCTTTAGCTGACTGCCACG
TCTCACAGAATCAACCTGAACCGCCCGTACGCCATCAACAAGATGCAGGAATATCTCCCGCATGCCAAGAAGCTGCTGGC
TTCACCGTATTGCCGGCCTGTCGACCACCGGATTTGCGCATACATCGAAGGCTTTATAATCACAGGTTCGTGTCTCCCGG
GACGGAAAGGAATGTCTAGGCGATGATCTGCTGACGTACCAGGCGATGCCAAGGCCCGCTTGCAGAGCGCCCATCTGCAG
GCGACCCCATTGCCAGACTTTGTGTCGAAGCTGCTGACCTCCTATGATCAGCAAGTGAACGCCTGGTTTCACAGGATCAA
CAACACCATCGATCCGCTCTTCCAGACGTTCGAAGCGACCCAAGACCGGAACAGGTTCATGGTTCCCTACGCGCTGGTAA
AACTGTGAGTTTAACCGTTCTTTTTTTGCATTTGTTAAAAGCGTGCTAACCACCGACCGTGTCTGAAGTTACGTCAACGG
TCTGGCCCTTCACGGCGTTGAACTGATCAAGGGCGACGTGGATCCTGTGAGGCTGAGCTTCGTCAAGACAGCATTGGCAA
GTGCTTGCCTGCTTCTCCAGACGCAGTGGGAGTCCCGCTCGTTTCGCCGCGCATTCCGCTACACGATCGTGGGTTGATTG
CCCATTCAATATTACTTGCTGCTAGTTGCTCTGACACTTGCATTCTAGGACTACAACGGCATAACTACCTTCCACGCCAG
CCGCTTCCTCCTCAAAGTCATGCACATCCTGCCTGACCAAATGGATGAGTCCAGCTACGTGGCTCTTAATCAGGCCTCAA
AATTGTTTGAGCTTGCTGGTGCCATGGATGTTGCCGAAGAGCTTCGCCGGGAGACGGAGAAATTCACTACCGTGGTCTCA
CCCCTCGAGCCGTCTCCAGAGACGGCCGCCGACTCGCAACCGGACACTCTCTTTGACATCCCCAATCTGCCTGACAGAAC
GGTGAGTGAGGCTTTCCCCCTGCCGTTGACAGTAGGACGACTAACCTGTCCTTACCCTACAAACAAAGACTTGGGACACC
GAGTTTCCTATGATTAACACATACACCCTGGAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62