GenePrediction:GLEAN_8272 Details

Name: GLEAN_8272
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_124:191301..187644 (- strand)
Length: 3658
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_124:191301..191293 (- strand)
Length: 9
Type: CDS
Source: GLEAN
Position: GCSC_124:191242..190855 (- strand)
Length: 388
Type: CDS
Source: GLEAN
Position: GCSC_124:190777..190075 (- strand)
Length: 703
Type: CDS
Source: GLEAN
Position: GCSC_124:190010..189955 (- strand)
Length: 56
Type: CDS
Source: GLEAN
Position: GCSC_124:189894..189713 (- strand)
Length: 182
Type: CDS
Source: GLEAN
Position: GCSC_124:189647..189457 (- strand)
Length: 191
Type: CDS
Source: GLEAN
Position: GCSC_124:189400..189374 (- strand)
Length: 27
Type: CDS
Source: GLEAN
Position: GCSC_124:189310..188926 (- strand)
Length: 385
Type: CDS
Source: GLEAN
Position: GCSC_124:188468..188336 (- strand)
Length: 133
Type: CDS
Source: GLEAN
Position: GCSC_124:188185..188146 (- strand)
Length: 40
Type: CDS
Source: GLEAN
Position: GCSC_124:188090..187999 (- strand)
Length: 92
Type: CDS
Source: GLEAN
Position: GCSC_124:187945..187644 (- strand)
Length: 302
>GLEAN_8272 class=GenePrediction position=GCSC_124:191301..187644 (- strand)
ATGACTAAAGTAAGTATGTCTCGACTCAATTCTTCGTCGTGCCATCTGACGTCGAGCAGTTCATTGTCGGGCCTTCAGAC
AATACGCTTGTAGAGTCCGCATCTACAGCCGCGTCCTCTCGGCCCTCGACTCCAAGAAGCAGCATTTCAATCAGTCTTTC
TGCTGCTCCTTCGCCTGATACACCTTTGATTGTCAACCCCCCATACGACGATGTCTCCGACAGCGAGTCATCACGGTTGA
CTACGCCTGCTGCATCTTCGATGACTTCTCTCAGCTCCGCGAGCTCTCTGGCATGTCGGATCCTGGACATGGCCGATGTC
TCGGCCGCCATTGCAAATGTAGCCCGCGAGTCCGAGCCCGACAGAAGATCACCCTCCCTGCTCGAGCCTGAGCCATCCAT
CGAGCACAGTCCTGCGGCTCGTCCACGCTCTGCCAGGAGATCGCGGGGTGGCTTTCTGGAGCAGGACTGCAGACATACAA
TGTCCGAGAGGATGAGCCGCCGCCCCACCGCTTCCACAATGCAGCCGTGCAGGGCGCTCTGAGCGATGCGAAGACGGCCA
TGGAGAACCTGCGTGACGTTCTAGCGAGCGATAGTCTGCACTTGGACTCGGACTCCACCATCGGACGGCTTCACAAACGG
ACCGAGGCACTGGCCTGCTTCGAGTGTCTGTCCAGCCGCACCGTCGGCTTTGTCGGTGCCTCGGGAGTCGGAAAGAGCAG
CCTCCTCAACGCCCTCCTGGACACGCGAGGACTGGCTAGGGCAAATGGTAATGGTGACGCCTGCACTTCTGTCGTCACCG
AATACCATTACCATGACCGGAATGACTTTGTCCTTGACGTGGAGATGTTCGCCATGGATGAGGTCGTCGAGCAGATAGGA
GACTTGCTGAAGTCTCTCCGGCAGTATCACAATTGTCTCCGTACCCACTATAAATTTACCGACAAGGACGAGCAGGAAGA
CATTGAGAGCAGGGCCAAGATTGCCTCCGACACCTTCCAGGCCATGTTTCGCAGCCGGATGGAAGACGAGCAGTACCTCT
TGGACGGGTCTGAAGAAAGCATACTGGCAACTTTGTGTGCCTGGACGGACGACTTGATGCCAAGACATATTGGTGGGAGA
CAGACGCTGGACAGCCTGGCAGCATGTTCCAGGGTTCTGATGCAATTGACGTCTGAGACGAATGCAGAGCCGCAGCCGGC
GGTATGGCCGTATATACGAAAGATCAAGTATGTGGCCTAAGATAGTCCAAGGCAGGGACAAAGTTTGACATCTGACAACC
GACAATTGCAGAGTATTCCTGAACGCCCATATCCTGAGCAAAGGACTTGTGCTTGTCGACCTCCCAGGTACGTGGTCGCT
CCGACCGCTGAAAGGCGACAAAGATATGCCTTCCTAACAATGTGCAGGTTTGCGCGACGTCAACCTGGCCCGACAGGTCA
TCACCGAGCTCTACCTCCGGGAGTGTGACGATATCTTTGCAGTCACCTGCACTAACCGAGCAGCAGCTGATGCCGGGGTT
AAGGACGTGTTTGAGCTCGGACAGAAGGCCGGACTGTCAAATATTGGCATTATCTGTACTAAGTCTGATGTGAGCGATGT
CGATAGTAATGTGCTGCTCTTCGTCGCATATCAGCGGCTGACTGTGTCTTCCAGGAGGTCGAAGCGGCAGAAGCCACCGA
CAGGACGACCCAGCAACTCCAGAGAGCGGTCGAAGGCAGCCAGAAAAATGCCAACGCCATTGAGTATGACATCCGTGAGC
TAGAGCAGCTACAGAGAGAAGATGACCTGCTTCCGGAAGAGGAAAAAGAGCTGGCGGATTTGTTGCGGCGGTCTAGAAAT
ATCAGGTGAGCACTGAGTCGGAGTCGGTTTGTACATCGGAACGAGTCTGACATTGTGACAGAACGGTGCTGGAGAGCCAA
AAGATAGAGTGAGTTGGCAAAGAGACTGCCCCACTGCTTACCGGCTATCTCGGCTGACATCGCATCTCTAGGCTCAAGAT
ACATCTGGTCAACACGCTGACGGCTGGCATCGACACGAAGCTTTGGGGCCTCTACAGCCGCTTTGTGCCCGGCGGTCATC
GGCTGCAAGTGTTCTGTGTCAGCAGCAAGGACTACTGGGAGATTCGCGCGCAGCCAAAGACTGATGTTGTCGTGCGCCTG
CTGAACGTGAGCGGAATCCCGGCCGTTCGAAAGCACTGTTTGGCCATGGTTGCCGATAGCAACCTCCGCATAGCCGCCAA
ATTTGTCCGTGACGACATCCCAGCCCTCCTCGGTGACATCGGCCTCTGGGTCCAGTCCGGTGCCGGCTGTCTGGTCGCCG
AGCAGAAAACGGCCATCCGCGATGCCCTAGACGCGCTCGAGCGTCGGCTGAAGACGGTGAGATTTGGGAAAGACCACCAA
CACTCGAGGAGCACACCACTGACGGCTTCAGGGACTAACAGGACGTAACTCCCCAATCTCGAACCTAGCCAAAGAATTGA
AAAACGAGTTCCAGACGCAGGTGTACAGCGGTGGGCTCGCCTTTCTCCTATGCATCTTCTAGTCTCGTACCAGCTGACTT
TTTAGGTCATAGCACTGGTGCATGGAGCCGAGAAGCAACAAGAGCGGCTTCTAATTGGACTTCTGTGAGACTTCCATTCC
AATTTAACCTGGCTCGGGTCCAAGATAGCTGACACATATCTGTTTCTCGTTCACAGTGGCATTCTTGTAAGTGCCGTAGT
AGCATCCTGTGGGCCGTGTACGCGTTCTAACCGCTGAAGCTTCCTATTCTGCATTCTGTCGCAATTACGGCAACCATAGC
ACTCCGGTGGCTGGCACGCATAATTGGAATCAGGAAGCTATTGAAGGCATGACCATTGATTTGCGTCCGCGGTGGGCAGC
ACTGCGTCTCGATTCTGTCGTCAGACAACAAAAGCATATCTCAGCCCATTTAAAGGACACCCTGGGACAAGAAGTCGAAC
ATCTCGGTAAGTATGGAGTAGTATAGGTCCCGATTGAGAGTGTATCTTGCTGATGCCCGTTGGCTACGGAATCAGAAAAT
AGGTTTGAAGATCTTCCACAGTCTCCAGCCACCCTCGTCCAAACTCTGCTGTATCGAGAGAACATTTTTCTTGCAGAAAT
TGAGGGCCGCTGCGAGGAGTTTGAGGATGACCTCTCGTAAGTGCAGCTGTCCAGACCGTGCTTGACCAAACTAACAGGCG
TGACTCACCAGATCGCTCGAGACAGACGCTCTTACTGGCATCCGGTCGTCACTGATTGGGAAAGCCATGGAGGAGGTTTA
TCGGGCTTCCGCAAATACCTCTGGTAAGATGCCTTTTTCGACATCCAATAGCAGTTACAACTGACGATAAAAATAGGAAG
AGGAAGCCATCGTGTGCGAGTCGATATCATCAACGGCACCATAACACAGCAGTCCACGTTTGACAAGCTGCTAAGGGACT
TTAAGAAGTGTTTCAACGACTTGGCAGATGGTCTGCAAAGGGACGCTAGTGAAATGGCCATGGCACACCTGGGGAGTATC
ACCGAGACGCTCAACATTGTCCGTAGCGAGAACATCATAACGGAGAGCGAGCAGAACCCCGAGTTTCGGCTAAATGTAGA
CGCGGGGGTCGGAGCTGCGACTGATGCCGTACAGCGTATCCAAAGGGTTGTAGCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62